I lost it at Humes lecture...seriously.
I've listened to quite a few lectures surrounding the issues in this debate, but the lecture I sat through tonight was by far the most difficult to stomach. In fact, I had to leave my chair at one point because the guy next to me was about to get slapped.
This has ~NEVER~ happened to me before, and I've always been extremely calm at these lectures regardless of how much I disagree with the speaker. I also get quite irritated when I hear someone badgering the speaker etc. even if I agree with their point.
But tonight was different, and I'm trying to sit back and reasonably consider the lecture again to try to figure out what it was that led me to the point of no return.
I think the main reason is this particular speaker has been prefacing his book and lectures with the notion that he is "unbiased" and "fair". He was introduced that way this evening as well. So, you'd hope to actually get an "unbiased and "fair" account. I was still hoping for some semblance of fair reporting when I walked in there tonight, but I was ~seriously~ disappointed. His lecture was worse than the book.
To be honest, I'd rather listen to Dawkins speak again than sit through another Humes lecture, because at least with Dawkins we know what we're getting. He certainly doesn't claim to be "unbiased".
I'd also like to know where one draws the line between describing someone as misleading and being an outright liar. Seriously. I've never heard so many half truths, half of the story, or outright unfair *speculation* in my life.
I had made it through most of the lecture when at one point I simply couldn't take it anymore and turned around to talk to a guy I knew who was sitting behind me. My whispering was getting a bit loud, and the guy next to me (who I recognized from many other lectures) looked at me and gave me an irritated "shhh". I bit back "don't tell me to hush". I seriously cannot believe I said that!!! He told me to go have my conversation outside, and at that point I just got up and left, because staying simply wasn't going to be a good thing.
I did talk to Humes for a second afterward and asked him a question about something he mentioned in his lecture that I still cannot believe he had the gall to relay to the public. After his response, I really lost it and told him I hope the DI gets a hold of his lecture tonight because it was the most misleading portrayal of the issues that I've ever heard.
I'm still in shock. I am always cordial to people regardless of their position in this debate, but tonight I was out of control. I think the reason I got to the point I did is because the man is basically either a liar or clueless.
So, I'm going to take a few days to calm down before I try to put together a review of the lecture. I'm not even sure my notes are worth much because I was pretty much livid throughout his entire spiel. I do plan on calling KU to see how soon they will be posting that lecture, because if this dude is spewing this particular version of supposed facts in regard to ID/creation/evolution, then someone needs to set him straight. Although, thankfully, it doesn't appear that he lectures too often and there were only around 80 in attendance tonight. But, if the Darwinists get a load of the spin he's pushing, they'll undoubtedly put the guy on the payroll (if they haven‘t already). They do love a good spin doctor.
In closing, if there are any DI fellows out there reading this...get a copy of this lecture, and be sure to have a dozen or so barf bags lined up before you listen to it.
Thursday, March 29, 2007
Wednesday, March 28, 2007
Behe/Dembski/Levin/Miller
David Levin, some biochemist, recently sent Behe a letter full of sneers and arrogance. Evidently, he was under the belief that he had destroyed Behe’s position. I see this kind of behavior on an hourly basis on the internet, but you’d think that Levin could manage to be civil and professional when writing a few emails to a fellow scientist regardless of whether he is in disagreement with Behe or not.
You can go to Uncommon Descent for the series of email exchanges between Levin, Behe, Dembski, and Miller. Behe, as usual, is polite to a fault. I’ve mentioned in the past that I saw Behe lecture here at KU a few months ago and the man is as calm as a cucumber. The crap thrown at him on an hourly basis must bounce right off the guy because he never throws a fit like the evolutionists do, nor does he resort to ridicule (as Ken Miller does). I’m thinkin’ that’s a true sign of confidence.
The evolutionists leading the pack cuss, complain, rant, and spew venom all over the media about Behe, and he just calmly takes down their arguments time and time again.
I’ve seen Dembski lecture and he was very professional as well (again, unlike Miller’s comedy act).
Anyway, evidently Dembski received an email from someone who was giving their impression of the email exchange. You can find it below:
There is a lot of hatred built up in some of these people, and I’m just willing to bet the farm that it’s not primarily due to the scientific issues surrounding this debate...
You can go to Uncommon Descent for the series of email exchanges between Levin, Behe, Dembski, and Miller. Behe, as usual, is polite to a fault. I’ve mentioned in the past that I saw Behe lecture here at KU a few months ago and the man is as calm as a cucumber. The crap thrown at him on an hourly basis must bounce right off the guy because he never throws a fit like the evolutionists do, nor does he resort to ridicule (as Ken Miller does). I’m thinkin’ that’s a true sign of confidence.
The evolutionists leading the pack cuss, complain, rant, and spew venom all over the media about Behe, and he just calmly takes down their arguments time and time again.
I’ve seen Dembski lecture and he was very professional as well (again, unlike Miller’s comedy act).
Anyway, evidently Dembski received an email from someone who was giving their impression of the email exchange. You can find it below:
“The unrestrained emotionalism of these people exposes an emotional element in their thinking that impeaches their claim to a level of rationality necessary to draw proper inferences from data. The experience of dealing with these emotional people is like finding yourself at a podium, and around you are a bunch of people holding protest signs denouncing you — and they expect you to argue with each slogan on each sign, or else they hold up another protest sign pronouncing that your silence demonstrates that you agree with the slogans on the other protest signs.”
There is a lot of hatred built up in some of these people, and I’m just willing to bet the farm that it’s not primarily due to the scientific issues surrounding this debate...
Interesting...
Via Casey at EN&V...
Testing by Comparing Predictions of Theories
Sober concedes that “many formulations of ID are falsifiable” and meet Karl Popper’s famous hallmark of a scientific theory . However, Sober critiques Popper’s usage of falsifiability as a hallmark property of science because he claims it does not always entail robust testability relative to other explanations. Sober prefers a definition of testability where testing is conducted by comparing a theory to other competing theories. He writes: “To develop an account of testability, we must begin by recognizing that testing is typically a comparative enterprise.”
In Sober's view, for ID to be testable it must make predictions with respect to evolution. Sober states, “If ID is to be tested, it must be tested against one or more competing hypotheses.” Since Sober measures ID’s testability by comparing it to evolution, it would seem that to be fair, Sober must measure evolution’s testability by comparing it to ID. Thus, the unavoidable conclusion seems to be that under Sober’s methodology, evolution can never be any more testable than ID. Obviously Sober believes evolution is a scientific theory, so doesn't that mean ID must also qualify as a scientific theory? Sober appears to apply a double-standard here.
In the end, Sober doesn’t even use this methodology. Instead, he ignores the wholly standard formulation of intelligent design in order to claim that it’s untestable. This will be explained more in Part II of this series.
Tuesday, March 27, 2007
The Saga Continues...
Casey addresses Miller's letter to Jeremy.
Casey is absolutely right, but I guarantee you won't find a Darwinist who will ever admit to it.
Casey is absolutely right, but I guarantee you won't find a Darwinist who will ever admit to it.
Monday, March 26, 2007
Laughing Out Loud...
Casey certainly has locked in on the 'ol ~Darwinist charm~.
These science "professionals" who support neo-Darwinism certainly act like a bunch of nasty mouthed school children out on the playground, don't ya think?
Now, I'm going to try to remember those good 'ol school days and bring out the holler back girls again to cheer Casey on...
Go get 'em, Casey!
These science "professionals" who support neo-Darwinism certainly act like a bunch of nasty mouthed school children out on the playground, don't ya think?
Now, I'm going to try to remember those good 'ol school days and bring out the holler back girls again to cheer Casey on...
Go get 'em, Casey!
Let it never be said that I don’t keep my promises
Okay, dave, I’ve been promising for a few weeks to answer some of your questions that I’ve let slip by due to lack of time.
Here you go...
Just thinking...
Dr. Egnor joins Evolution News & View
Evolutionary yearnings?
From Faith in God to Faith in Science
Hope you make it through all that without falling asleep!!
Here you go...
Just thinking...
Dr. Egnor joins Evolution News & View
Evolutionary yearnings?
From Faith in God to Faith in Science
Hope you make it through all that without falling asleep!!
Theistic Evolutionists
Ed Humes at KU this Wednesday
Ed Humes, author of Monkey Girl, will speak this Wednesday, March 28 @ 7:30pm, at the Dole Institute located on KU campus.
I will say, as an author, he writes a very interesting book. I may have to read some of his other books that are not connected with the evolution debate to appreciate his writing a bit more.
Hopefully I’ll have time to stay and have him sign my copy of his book. But, I’ll be kind of embarrassed due to all the highlighter and post-it notes all over the place.
Hopefully he won’t notice??
I will say, as an author, he writes a very interesting book. I may have to read some of his other books that are not connected with the evolution debate to appreciate his writing a bit more.
Hopefully I’ll have time to stay and have him sign my copy of his book. But, I’ll be kind of embarrassed due to all the highlighter and post-it notes all over the place.
Hopefully he won’t notice??
Weigh-in Week 12, March 26

We've completed week 11, with our total weight loss at 86 lbs...
We're losing steam...last week was pretty weak with a total weight loss of only 4 pounds... most of that coming from Dave. Come on girls!! Let's keep after it. We've been doing great, and bathing suit season is just around the corner.
Dieters, please use the comment section to post how much you lost (or gained) this week, and your ~total~ weight loss since day 1 of dieting. When everyone has done so, I’ll post the results.
UPDATE
Davescot -3 this week, -24 total
Starving +3, -18
Ftk -1, -14
Sparky -1, -13
Gigi -0, -8
Carb Princess -0, -5
Chunky Monkey -0, -5
Manna 0, -1
Find previous diet links below:
Week 11
Week 10
Week 9
Week 8
Week 7
Week 6
Saturday, March 24, 2007
Had enough and not going to take it anymore!
Um...evidently the Discovery Institute has had enough of Ken Miller's misleading lectures, articles and books. They are addressing a multitude of Miller's misconceptions about ID.
Gosh, that's a lot to read through. I better get started!
I'm thinkin' Ken's not going to take this sitting down. Perhaps we'll hear from him? It certainly would be interesting to get his take on each of these accusations.
Gosh, that's a lot to read through. I better get started!
I'm thinkin' Ken's not going to take this sitting down. Perhaps we'll hear from him? It certainly would be interesting to get his take on each of these accusations.
More on censorship
There is an interesting post over at Telic Thoughts regarding this latest call for censorship.
The comments are worth considering. Nick Matzke commented that:
Mike Gene and Krauze set him straight though...
Mike states that:
But, then that’s a whole different deal apparently.
Nick seems to be so very opposed to ID and certain forms of religion. I wonder what religion he is affiliated with.
The comments are worth considering. Nick Matzke commented that:
No, I don't think that's the major thing that is bugging the profs. The major issue bugging them is (1) this is really an apologetics revival meeting for a specific form of conservative Christianity, but (2) it is disguised as a scientific "conference", as if SMU was hosting a scientific conference on intelligent design like SMU might host some other scientific meeting.Nick has a real active imagination. The design inference, in his mind, is a huge conspiracy posed to vault a “specific form of conservative Christianity” onto our poor unexpecting students. It's all part of a huge brain washing indoctrination attempt. Good grief.
I think you could expect a similar reaction if e.g. a conservative Mormon group disguised their apologetics meetings as "scientific conference" on "archaeology of North America."
Mike Gene and Krauze set him straight though...
Mike states that:
Lot's of things bug me. But I have never thought that justification for advocating censorship.Krauze brings up a good point:
Nick, do you support free speech?
Would you expect a similar reaction if a scientist used the celebration of science and evolution as a pretext to tell the audience that God didn't exist and that human free will is nonexistent?”No telling what all was said at those big Darwin Day events on campuses throughout the country.
But, then that’s a whole different deal apparently.
Nick seems to be so very opposed to ID and certain forms of religion. I wonder what religion he is affiliated with.
Censorship of ID, freedom of expression for everything else
Sage words from Robert Crowther at Evolution News and Views.
Yes, indeed. It appears that the Darwinist crowd at Southern Methodist University are demanding that the university withdraw permission for the Darwin vs. Design conference I mentioned in an earlier post.
Such a puzzling world we live in. As I surf the web from one Darwinist site to another, it seems that most of these folks are die hard liberals who believe that there should never be censorship of anything in our schools and universities. Free speech is a really big deal for them, and most are avid supporters of gay marriage and have no problem teaching our kids that this lifestyle is completely acceptable.
We're all encouraged to embrace this lifestyle, and parents are not allowed to have a say in the matter because our concerns are “religious”, and everyone knows that there is a separation of church and state so we need to keep our concerns buried within the confines of the church. Basically, we’re told to shut our mouths about these issues when in public because our “religious” morality is stifling to the rest of society.
Parents evidently have no rights when it comes to their children being indoctrinated by the gay agenda.
Oh, and don’t get me started on the books that some of our students are reading. There are hundreds of classics out there that could replace the questionable material found in some of our classrooms, but to suggest that is the equivalent to suggesting a huge book burning escapade.
Yes, this drives our dear Darwin supporters here in Kansas into a tirade. Red State Rabble and Evolving In Kansas blogs declare it censorship to suggest that we replace some of the smut our kids are reading with other classic literature. Evidently, it is vital that we allow our children to read smut in order for them to function in society (as if they don‘t get enough of it when they are not at school).
Let’s take a look at some of the verbiage in those books that Blue Valley is opposed to. The words that follow are from a book titled Bastard Out of Carolina:
I kid you not. Books like this are apparently in our high schools, and some of them are even read in literature classes.
Here is a list of great books that the Blue Valley district is not using in those literature classes. Yet, the Darwinist crowd who were discussing this issue saw no reason to offer these more suitable books to our students. They thought the list of books in question were totally acceptable for our students.
So, evidently censorship is a BIG, BIG deal, UNLESS it is in regard to the science that questions their Darwinian worldview.
Strange world we live in. It appears that anything that can be even remotely traced to religion is now outlawed, and porn, homosexuality, explicit sexual content in books, and naturalistic creation stories are A-Okay.
Ugh....Ugh....Ugh....Ugh.
And, they wonder why the religious right is concerned about where we are headed.
It seems to me that if the Darwinists were confident in the strength and merits of their arguments, they wouldn't need to censor other viewpoints and stifle debate.Anika Smith mentions the current call for censorship as well.
Yes, indeed. It appears that the Darwinist crowd at Southern Methodist University are demanding that the university withdraw permission for the Darwin vs. Design conference I mentioned in an earlier post.
Such a puzzling world we live in. As I surf the web from one Darwinist site to another, it seems that most of these folks are die hard liberals who believe that there should never be censorship of anything in our schools and universities. Free speech is a really big deal for them, and most are avid supporters of gay marriage and have no problem teaching our kids that this lifestyle is completely acceptable.
We're all encouraged to embrace this lifestyle, and parents are not allowed to have a say in the matter because our concerns are “religious”, and everyone knows that there is a separation of church and state so we need to keep our concerns buried within the confines of the church. Basically, we’re told to shut our mouths about these issues when in public because our “religious” morality is stifling to the rest of society.
Parents evidently have no rights when it comes to their children being indoctrinated by the gay agenda.
A federal judge threw out a lawsuit filed by parents who wanted to keep their young children from learning about same-sex marriage in school. The judge, Mark L. Wolf of Federal District Court, said the courts had decided in other cases that parents’ rights to exercise their religious beliefs were not violated when their children were exposed to contrary ideas in school. Schools are “entitled to teach anything that is reasonably related to the goals of preparing students to become engaged and productive citizens,” Judge Wolf said. The parents who filed the lawsuit, Tonia and David Parker of Lexington, sued after their 5-year-old son brought home a book from kindergarten that depicted a gay family. Another Lexington couple joined the lawsuit after a second-grade teacher read a class a fairy tale about two princes falling in love. Jeffrey Denner, a lawyer for the parents, said they would file a federal appeal and refile state-court claims.Universities allow courses on pornography, and Sex Workers Art Shows on campus which featuring topless dancers, demonstrations of sex toys, Q&As with male and female prostitutes, etc., but try to hold a conference on Intelligent Design and the crowd goes WILD. That must be stopped in it’s tracks. It’s WRONG. It’s not science! Bring back the prostitutes and porn! We can’t have these “religious” fanatics telling us about science!!!!
Oh, and don’t get me started on the books that some of our students are reading. There are hundreds of classics out there that could replace the questionable material found in some of our classrooms, but to suggest that is the equivalent to suggesting a huge book burning escapade.
Yes, this drives our dear Darwin supporters here in Kansas into a tirade. Red State Rabble and Evolving In Kansas blogs declare it censorship to suggest that we replace some of the smut our kids are reading with other classic literature. Evidently, it is vital that we allow our children to read smut in order for them to function in society (as if they don‘t get enough of it when they are not at school).
Let’s take a look at some of the verbiage in those books that Blue Valley is opposed to. The words that follow are from a book titled Bastard Out of Carolina:
Language includes motherfucker, fucked, Jesus, shit, piss, dick, prick, goddam, Jesus Christ, jackshit, scared shitless, son of a bitch, hell, shitting, nigger, Goddammit, hardass, shitfire, bullshit, shit for brains, sack of shit, shit-faced, turd-eating, cunt.And, that’s just from ONE book! There are many others that are being disputed as well.
• I don’t need no man to tell me jackshit about my child...glad the goddam courthouse burned down.
• Of course, he was a black-eyed bastard himself...the boy was just too fertile. He couldn’t plow a woman without making children...It don’t really make a titty’s worth of difference.
• Rinsed it in piss, she did, every Sunday...all ‘cause Granny swore baby-piss rinses would keep her blond...
• ...slid his left hand down between my legs, up against my cotton panties. He began to rock me then, between his stomach and his wrist, his fingers fumbling at his britches. It made me afraid, his big hand between my legs…his hand dug in further. He was holding himself in his fingers...scary and hard. He grunted, squeezed my thighs between his arms and his legs...his hips pushed up…he was hurting me...brought his hand up to wipe it on the blanket, and I could smell something strange and bitter on his fingers.
• Boatwright women got caustic pussy. Kills off or messes up everything goes in or out their legs, except purebred Boatwright babies and rock-hard Boatwright men.
• (talking about mixed-race babies): The Yarboros been drowning girls and newborns for surely 200 years.
• (Glen) gets crazy when he’s angry. Use his dick if he can’t reach you with his arms, and that’ll cripple you fast enough...Man’s got a horse dick.
• Mama and Daddy Glen always hugging and rubbing on each other…Sex. Was that what Daddy Glen had been doing to me in the parking lot? Was it what I had started doing to myself whenever I was alone in the afternoons? I would imagine being tied up...while rocking on my hand...I came. I orgasmed on my hand...
• Goddam motherfucker son of a bitch shitass!... If he was my husband, I’d shoot his dick off.
• (Bone, age 9, gets beaten): ...lifted me high, shaking me back and forth till my head rocked on my neck. You bitch. You little bitch. My body slammed the wall...I was under his arm being carried…to the bathroom. He kicked the door shut...he pulled his belt free...I’ve waited a long time to do this, too long...
• (Glen lies to Anney about the reason for the beating): I heard everything he said, heard Mama crying in his arms. Daddy Glen told her I had called him a bastard, that I had (been) knocking things over and called him that name. (Glen said): She told me she hated me...and I went crazy, Anney...Do you understand how much I love you all, love her?...The sound of Mama’s crying grew softer…I heard Daddy Glen whispering…Then they were making love.
• My fantasies got more violent and more complicated as Daddy Glen continued to beat me with the same 2 or 3 belts he’d set aside for me...hung behind the door of his closet...I would reach up and touch the leather...I was ashamed of myself for the things I thought about when I put my hands between my legs, more ashamed for masturbating to the fantasy of being beaten than for being beaten in the first place…I loved those fantasies…they made me have shuddering orgasms.
• My cousins loved my stories—especially the ones that featured bloodsuckers who consumed only the freshly butchered bodies of newborn babies…My stories were full of boys and girls gruesomely raped and murdered, babies cooked in pots...
• ...he’s just a little boy himself...wanting to be her baby more than her husband…Men are just little boys climbing up on titty whenever they can...(joke): What’s a South Carolina virgin? ‘At’s a 10-year-old can run fast.
• ...his hands sliding over my body, under my blouse, down my shorts, across my backside, calluses scratching my skin, his breath fast and hard above me as he pulled me tighter and tighter against him...
• (Shannon Pearl, the fat, mean, albino daughter of overprotective parents who book traveling gospel singing acts): Shannon invariably told horrible stories, most of which were about the gruesome deaths of innocent children...And then the tractor backed up over him, cutting his body in three pieces, but nobody seen it or heard it, you see, ‘cause of the noise the thresher made. So then his mama come out...she put her foot down right in his little torn-open stomach...
• Aunt Raylene had said about Mrs. Pearl—If she’d been fucked right just once, she’d have never birthed that weird child...That child will rot fast when she goes...
• (Shannon and Bone fight about Bone’s family): Everybody knows you’re all a bunch of drunks and thieves and bastards. Everybody know you just come round so you can...beg scraps we don’t want no more...You bitch, you white-assed bitch…You little shit, you fuck off. You just fuck off!
• (Bone watches Shannon burn to death at a barbecue): One of Shannon’s cousins (said), You must eat nothing but pork since you was born. Turned you into the hog you are...Jesus shit, I muttered…Shannon reached for the can of lighter fluid…poked the coals and sprayed them…I heard the lighter fluid can sputter and suck air. I saw the flame run right up to it and go out. Then it came back with a boom. The can exploded...saw Shannon stagger...dress was gone...saw the smoke turn black and oily.
• (Bone finds a huge hook--her aunt tells her it’s for dredging bodies from the river): ...pried the chain off, cleaned and polished it. When it was shiny and smooth, I got in bed and put it between my legs, pulling it back and forth. It made me shiver and go hot at the same time. I had read in one of the paperbacks Daddy Glen hid...about women who pushed stuff up inside them. I held the chain and thought about that...
• He fumbled with his fingers between my legs, opened me, and then reared back slightly...slammed his body forward from his knees...He rocked in and ground down, flexing and thrusting his hips. I felt like he was tearing me apart, my ass slapping against the floor with every thrust...his hips drove his sex into me like a sword...He went rigid, head back and teeth showing...He went limp and came down on me, rag-loose and panting.
I kid you not. Books like this are apparently in our high schools, and some of them are even read in literature classes.
Here is a list of great books that the Blue Valley district is not using in those literature classes. Yet, the Darwinist crowd who were discussing this issue saw no reason to offer these more suitable books to our students. They thought the list of books in question were totally acceptable for our students.
So, evidently censorship is a BIG, BIG deal, UNLESS it is in regard to the science that questions their Darwinian worldview.
Strange world we live in. It appears that anything that can be even remotely traced to religion is now outlawed, and porn, homosexuality, explicit sexual content in books, and naturalistic creation stories are A-Okay.
Ugh....Ugh....Ugh....Ugh.
And, they wonder why the religious right is concerned about where we are headed.
Thursday, March 22, 2007
Just thinking...
I got to thinking about Ed Humes' ability to paint a picture of his subject with his subtle descriptions. I mentioned in this post that it seemed to me that the ID supporters were always painted negatively while the evolutionists descriptions were more flattering.
First he says “the creationist take” which seems to automatically link creationist with ID again. Then he says “who calls herself” ForTheKid. First of all its ~ForTheKid*s*~, and something just somehow sounds demeaning in the way he says that. It seems as though he could have just used my blog name like he did everyone else. We have “Evolving Thoughts”, “Red State Rabble”, “Pharyngula” and “Evolving in Kansas”, but I’m just referred to as that freaky creationist who “calls herself ForTheKid*s*”. I suppose he couldn't bring himself to print the words "Reasonable Kansans".
I feel insulted somehow, but perhaps I'm just being too sensitive about these descriptions?
Looks like he likes Pat & PZ though....figures. I'm going to have to have a little talk about this with him after his lecture next week at KU. I just can't believe he likes those two meanies better than me!!
His descriptions of people throughout were very telling in that every person who did not support Darwinism was painted as a person who was trying to force religion into the schools. There were also negative overtones in regard to their descriptions such as "his eyes burning and birdlike", "something of a loose cannon", "an affable, balding law professor in his sixties with a conspicuous gray comb-over", "the big, bluff animal doctor", or "a young attorney...with a soft, hoarse voice, a pained expression on his face, and a poker hand he didn't seem to relish...". Humes is a master of subtle digs against those who support design, but his description of Miller, Matzke, Scott, Forrest, and the Dover science teachers are glowing, with Miller even being compared to a "rock star".Well, it just dawned on me that he did the same thing to me when he linked to my blog from his website:
A brief but revealing back-and-forth between opposing points of view on this Talk Radio Evolution theme can be found at Evolving Thoughts, while the creationist take from someone who calls herself ForTheKid can be found here.It's almost like sending subliminal messages...
Monkey Girl in the Blogosphere — Two popular blogs have reviewed Monkey Girl. Red State Rabble brings a Kansas perspective to the story, having lived through and ably documented the evolution wars in the Sunflower State for years, while PZ Myers complains (ever so nicely) over at Pharyngula that Monkey Girl kept him up too late reading. Update: Evolving in Kansas finds Monkey Girl a good read, too. [my emphasis]
First he says “the creationist take” which seems to automatically link creationist with ID again. Then he says “who calls herself” ForTheKid. First of all its ~ForTheKid*s*~, and something just somehow sounds demeaning in the way he says that. It seems as though he could have just used my blog name like he did everyone else. We have “Evolving Thoughts”, “Red State Rabble”, “Pharyngula” and “Evolving in Kansas”, but I’m just referred to as that freaky creationist who “calls herself ForTheKid*s*”. I suppose he couldn't bring himself to print the words "Reasonable Kansans".
I feel insulted somehow, but perhaps I'm just being too sensitive about these descriptions?
Looks like he likes Pat & PZ though....figures. I'm going to have to have a little talk about this with him after his lecture next week at KU. I just can't believe he likes those two meanies better than me!!
Never have understood Ken Miller
It just seems to me that he must have played one to many games of Twister as a child. He can twist the real facts into a pretzel, and come out looking like a "rock star". The problem is that his audience ends up clueless as to was the design inference is really all about.
But, evidently he must be more comfortable with a deck of cards than that game of Twister:
Now, I for one don't think that Ken is being deliberately misleading in his presentations on ID, though I'm trying desperately to figure out how he comes to the conclusions that he does. When I attended his lecture at KU, I thought he was twisting a few things myself.
But, let's give the guy the benefit of the doubt. The only other thing I can come up with is that he just doesn't understand ID and the many facets of evolution.
So, I'm thinking that we should educate him by setting up a closed door meeting between him and perhaps Dembski, Behe and Meyer. Miller can bring along Dawkins and PZ Myer. And, let's say Casey Luskin and Nick Matzke get to take notes and report back to the troupes. We'll keep DaveScot out in the hall just in case we need a bouncer.
Wouldn't that be fun? And, nobody can leave the room until they come up with a game plan to end this whole bloody mess. After a few friendly departing hand shakes and hugs, we'll unlock the doors and let them return to their day jobs.
Oh, and I get to be referee!!! But, Eugenie and Barbara aren’t allowed in the building or the guys may end up having to stop me from starting a cat fight. If it comes to that, I'm inviting Ann Coulter for back up.
But, evidently he must be more comfortable with a deck of cards than that game of Twister:
"One of the mathematical tricks employed by intelligent design involves taking the present-day situation and calculating probabilities that at the present would have appeared randomly from events in the past. And the best example I can give is to sit down with 4 friends, shuffle a deck of 52 cards, and deal them out, and keep an exact record of the order in which the cards were dealt. We could then look back and say ‘my goodness, how improbable this is, we could play cards for the rest of our lives and we would never ever deal the cards out in this exact same fashion.’ And you know that’s absolutely correct. Nonetheless, you dealt them out and nonetheless you got the hand that you did."Casey Luskin counters:
His point is that some unlikely events should NOT be attributed to design, but rather are best explained by chance. Dembski’s fundamental premise is that Miller’s random poker hand is a perfectly good example of an unlikely event which is best explained by chance. But what happens when one is dealt 50 consecutive royal flushes? What happens when the stones spell out “Welcome to Wales by British Railways”? Clearly, not all unlikely events are best explained by chance, especially when they conform to a special type of pattern. Dembski calls this conformation to a pattern "specification."Be sure to read the whole article and the links, and you'll get a better understanding of the design inference.
The design inference therefore requires unlikelihood (related to complexity) coupled with specification. Miller implies that Dembski infers design by the mere unlikelihood of an event, but Miller egregiously ignores the fact that according to Dembski, we must also have specification to infer design. Dembski even uses this very example of dealing a hand of cards when illustrating an unlikely but yet non-designed event.
Now, I for one don't think that Ken is being deliberately misleading in his presentations on ID, though I'm trying desperately to figure out how he comes to the conclusions that he does. When I attended his lecture at KU, I thought he was twisting a few things myself.
But, let's give the guy the benefit of the doubt. The only other thing I can come up with is that he just doesn't understand ID and the many facets of evolution.
So, I'm thinking that we should educate him by setting up a closed door meeting between him and perhaps Dembski, Behe and Meyer. Miller can bring along Dawkins and PZ Myer. And, let's say Casey Luskin and Nick Matzke get to take notes and report back to the troupes. We'll keep DaveScot out in the hall just in case we need a bouncer.
Wouldn't that be fun? And, nobody can leave the room until they come up with a game plan to end this whole bloody mess. After a few friendly departing hand shakes and hugs, we'll unlock the doors and let them return to their day jobs.
Oh, and I get to be referee!!! But, Eugenie and Barbara aren’t allowed in the building or the guys may end up having to stop me from starting a cat fight. If it comes to that, I'm inviting Ann Coulter for back up.
Evolutionary yearnings?
I have no idea what to categorize this under other than WTF? Excuse my language, but this story pretty much boggles the mind...
What on earth is the evolutionary explanation for bestiality? Is it the ~all powerful~ natural selection’s yearning to cross species or what!?
Apparently not in this case, as this guy kills his object of affection before he gets off on it.
Just ~WOW~.
SUPERIOR, Wis. — A 20-year-old man received probation after he was convicted of having sexual contact with a dead deer. The sentence also requires Bryan James Hathaway to be evaluated as a sex offender and treated at the Institute for Psychological and Sexual Health in Duluth, Minn.??
What on earth is the evolutionary explanation for bestiality? Is it the ~all powerful~ natural selection’s yearning to cross species or what!?
Apparently not in this case, as this guy kills his object of affection before he gets off on it.
Just ~WOW~.
Gore Gorging on Energy
Dr. Egnor is on a roll
Michael Egnor will be writing a series of articles further covering his stance that Darwinism is irrelevant to the practice of medicine. The first entry can be found here. I'll keep posting them as they show up on Evolution News & Views.
***Update***
Here's another Egnor post for your enjoyment:
Quick, Nurse, Give the Patient a Tautology!
Funny stuff:
Another post from a ‘Bastion of S***headed Ignorance’
Evolutionary paleoneurology. The mind reels.
***Update***
Here's another Egnor post for your enjoyment:
Quick, Nurse, Give the Patient a Tautology!
Funny stuff:
Is Darwinism essential to understanding bacterial resistance to antibiotics? Consider the following conversation, at the bedside of a patient with a serious antibiotic-resistant infection:Along with his earlier posts...
Nurse: Nothing’s working, Doctor!
Doctor: I know. All of our antibiotics have failed. Penicillin, Cipro, Tetracycline. Nothing is working.
Nurse: Let’s ask the Darwinists for help!
Doctor: (Slaps forehead) Of course! Darwinism is the foundation of our understanding of bacterial resistance to antibiotics. Quick, Nurse, give the patient a tautology!
Another post from a ‘Bastion of S***headed Ignorance’
Evolutionary paleoneurology. The mind reels.
Wednesday, March 21, 2007
From faith in God to faith in Science
And they say science never leads to atheism...
Hmmm...one has to wonder if Shelley has considered the evidence that supports the Christian faith or if she has merely rejected it due to her rather dogmatic upbringing. Dogma can be a nasty thing regardless of whether it is found in the realm of religion or science.
Interesting story though.
After receiving a liberal arts education, taking my first evolution class, and meeting some honest-to-god (GASP!) atheists, my entire world-view was crumbling. It was devastating to come face to face with the demise of everything you had built your entire life around. I tried to deny it, but I couldnt'---the evidence was too great. I knew it, but still, I couldn't let go completely. I so desperatly *wanted* there to be a God, who loved and cared and would reward us with paradise. And for awhile, this desire was enough to drown out that "devil on my shoulder" who was whispering "you know it, you know it, you know it, just accept it." Finally, I did. I accepted it. And it was such a liberating, free-ing experience that in my mind I always equated it with "waking up from the Matrix." I took the Red Pill.
Hmmm...one has to wonder if Shelley has considered the evidence that supports the Christian faith or if she has merely rejected it due to her rather dogmatic upbringing. Dogma can be a nasty thing regardless of whether it is found in the realm of religion or science.
Interesting story though.
Tuesday, March 20, 2007
Fossils are Bullshit
Dilbert cartoonist Scott Adams' bullshit detector is evidently working overtime:
Pretty funny read...
[hat tip to Denyse O'Leary at UD]
I’ve been trying for years to reconcile my usually-excellent bullshit filter with the idea that evolution is considered a scientific fact. Why does a well-established scientific fact set off my usually-excellent bullshit filter like a five-alarm fire? It’s the fossil record that has been bugging me the most. It looks like bullshit. Smells like bullshit. Tastes like bullshit. Why isn’t it bullshit? All those scientists can’t be wrong.
If you are new to the Dilbert Blog, I remind you that I don’t believe in Intelligent Design or Creationism or invisible friends of any sort. I just think that evolution looks like a blend of science and bullshit, and have predicted for years that it would be revised in scientific terms in my lifetime. It’s a hunch – nothing more.
Yesterday I read this article in Newsweek about how DNA testing is being used to show that, well, fossils are bullshit.
Pretty funny read...
[hat tip to Denyse O'Leary at UD]
Monday, March 19, 2007
Richard Hughes is upset with me (again)
Sigh...
It looks as though DaveScot is not the only one the kiddos over at the Antievolution forum are going to stalk. They're evidently quite put off with me for not putting all of their comments through moderation.
They think I'm "unreasonable", "dishonest", a "liar", "pathetic", and a "moron". I evidently suffer from a "credibility crisis", "don't have any personality", and only have influence on those individuals who have "half a brain".
Richard, the reason why I didn't put your comment about the Wedge document through is because I have addressed that issue so many times in the past that it simply gets tiring. If you're interested in my response about it, go back through my archives and read to your hearts content.
Anyway, if any of you out there are interested in the comments from my friends over at Antievolution forum that I'm not allowing through moderation, please feel free to visit their thread documenting those comments.
I certainly don't want to upset those fine folks.
It looks as though DaveScot is not the only one the kiddos over at the Antievolution forum are going to stalk. They're evidently quite put off with me for not putting all of their comments through moderation.
They think I'm "unreasonable", "dishonest", a "liar", "pathetic", and a "moron". I evidently suffer from a "credibility crisis", "don't have any personality", and only have influence on those individuals who have "half a brain".
Richard, the reason why I didn't put your comment about the Wedge document through is because I have addressed that issue so many times in the past that it simply gets tiring. If you're interested in my response about it, go back through my archives and read to your hearts content.
Anyway, if any of you out there are interested in the comments from my friends over at Antievolution forum that I'm not allowing through moderation, please feel free to visit their thread documenting those comments.
I certainly don't want to upset those fine folks.
Billions of Missing Links

My copy of Billions of Missing Links came in the mail today.
Interestingly enough, the author, Geoffrey Simmons, an M.D. and a senior fellow at the Discovery Institute, will be featured on Coast to Coast, with George Noory on Tuesday, March 20th.
Egnor under fire
PZ's choir boys apparently think Egnor should be removed from some of his duties due to his involvement with the DI and the articles he has written for Evolution News and Views. A few of them have even contacted Stony Brook to complain about him.
Check it out.
Academic freedom is evidently only an option for those who support neo-Darwinism.
Sheesh!
Check it out.
Academic freedom is evidently only an option for those who support neo-Darwinism.
Sheesh!
Darwin vs. Design

If you live in Knoxville, TN or Dallas, TX, you’re in for a treat...
The Darwin vs. Design Conference is coming your way. Man, I wish I had the time to go to that.
Featured speakers will include: Lee Strobel, Michael Behe, Jay Richards and that cutie patootie, Stephen Meyer...

Yummy.
I was able to attend one day of the Kansas hearings way back when. Stephen Meyer spoke via speaker phone, and afterward Pedro Irigonegaray cross examined him with the same set of rather amusing questions that he asked every witness. Meyer wasn’t about to take any crap from him, whatsoever. He was my hero for the day...
Judge Jones & Monkey Girl
I ran across Judge Jone's endorsement of Ed Humes book, Monkey Girl:
How anyone can consider Hume's book as being a balanced account is certainly beyond me.
Judge John E. Jones III, Kitzmiller vs. Dover presiding judge: “Ed Humes' remarkable and balanced narrative has captured the essence of this complex and emotional dispute. When discussing the trial I have frequently found myself saying that to truly understand it, you had to be there. Humes' compelling book accomplishes just that.”Simply breathtaking...
How anyone can consider Hume's book as being a balanced account is certainly beyond me.
Week 11 Weigh-in, March 19

We've completed week 11, with our total weight loss at 82 lbs..
WOW! 82 pounds is pretty darn good, people!! I wonder if we could hit 100 lbs? That should be our next goal!
Last week our dieters were pretty quiet, so let's see if they were able to maintain or lose anything this week.
Dieters, please use the comment section to post how much you lost (or gained) this week, and your ~total~ weight loss since day 1 of dieting. When everyone has done so, I’ll post the results.
UPDATE
Starving -0 this week, -21 total
Davescot -3, -21
Ftk -1, -13
Sparky -0, -12
Gigi -0, -8
Carb Princess -0, -5
Chunky Monkey -0, -5
Manna 0, -1
Find previous diet links below:
Week 10
Week 9
Week 8
Week 7
Week 6
Sunday, March 18, 2007
Finished reading Monkey Girl
My family went on a quick camping trip this weekend. Two words...cold & windy. But, it did give me some quiet time with my family away from all the hustle and bustle of normal life. I also found time to finish reading Monkey Girl.
The book did put a bit of a damper on my usually festive camping mood. It made me feel profoundly sad. This sadness didn't center around the issues in the debate but rather the way in which people treated each other throughout the Dover ordeal. The bitterness, spite, anger, and resentment throughout left me with an awful feeling that I still haven't shaken.
Humes sees only one side of this situation, and that is unfortunate. His descriptions of people throughout were very telling in that every person who did not support Darwinism was painted as a person who was trying to force religion into the schools. There were also negative overtones in regard to their descriptions such as "his eyes burning and birdlike", "something of a loose cannon", "an affable, balding law professor in his sixties with a conspicuous gray comb-over", "the big, bluff animal doctor", or "a young attorney...with a soft, hoarse voice, a pained expression on his face, and a poker hand he didn't seem to relish...". Humes is a master of subtle digs against those who support design, but his description of Miller, Matzke, Scott, Forrest, and the Dover science teachers are glowing, with Miller even being compared to a "rock star". The term "creationism" (whatever that truly is) is painted as a fanatical right wing belief that only those who are ignorant or liars would associate themselves with it.
Poor Bill Buckingham is ripped up one side and down the other by both sides in the debate. I have to wonder if anyone who opposed his judgment on various issues throughout the whole affair ever approached him personally, one on one, just to see how he was feeling. Apparently, if Humes account is correct, during the time he was on the board and supporting ID he was taking OxyContin for an injury, his mother died, his father died, his dog died, two close Uncles died, his closest aunt died and his neighbor's daughter committed suicide (he was the first to find her). He also considered suicide.
Was anyone around for him? Did the science teachers realize this was going on? Did they care? If they did try to help and he wouldn't accept their help, did they voice their concerns to his clergy or someone who he might be comfortable talking with?
Where is the compassion for others? Why don't people listen to one another with respect and consideration for viewpoints that don't exactly jive with their own? How did this situation go to the lengths that it did? Who would sue over a simple paragraph like the one that was approved by the board? And, when the ACLU took up with those parents who were disgruntled, if I had been a board member, I would have just said let's drop the whole thing because it's not worth the trouble. There are better venues in which to approach this growing acceptance of Intelligent Design and perhaps the evolutionists are right in saying that it should not be brought to the schools yet. Because, as we have seen, the Dover science teachers didn't seem to have any more knowledge about the movement than the board members. Teachers in general have no idea what intelligent design is, and they certainly are not familiar with the arguments against Darwinism because they have never had the opportunity to learn about these issues from anyone other than Darwin supporters.
What people refuse to acknowledge is that there are two distinct interpretations of the scientific data when it comes to origins, and to dismiss either is simply wrong. In the end, that is what this all boils down to -- regardless of what anyone will admit. Is there a higher source of intellect responsible for our existence or not, and can we detect the design in nature that this higher source may have been responsible for?
Although Humes would have us believe that those who support ID are ingenuous, ill informed religious extremists, he never mentions much at all about the fact that the majority of those on the other side of this debate are quite hard core in their atheist or agnostic beliefs. He, like Judge Jones, does not find this relevant at all.
Time and time again we are given examples of something that an ID supporter said that would acknowledge that they do believe in God and do hold certain religious beliefs. Although, this has absolutely nothing to do with the science of ID at all, it is the number one consideration in whether the design inference should be considered scientific.
It’s interesting that Humes gives the flamboyant atheist and University of MN biology professor, PZ Myers, this flattering description:
He never mentions that right under the title of Myers blog site are these words:
"Evolution, development, and random biological ejaculations from a godless liberal".
Nor does he mentions that Myers has what seems to be a mission to degrade religious thought at every possible opportunity. Some of the categories of his blog include: "godlessness", "kooks", and "creationism", in which he daily rips apart those whose views differ from his own atheistic religious outlook on life. He's harsh, cruel, and unjustly bitter toward religion. I once tried emailing PZ and reasoning with him, but he said something negative and told me he wouldn't respond to any further emails from me. I said nothing disrepectful or nasty, but he refused to even consider my concerns. I was told to go away.
There are many like him involved in this debate and that is why people like Bill Buckingham are concerned. But, Humes considers these concerns somewhat imaginary and that they are merely instigated by people like Kent Hovind. One certainly doesn’t have to listen to Hovind to know that there are many Darwinists out there who reject God. Just surf the Internet for a few days and you'll understand quite quickly that Bill's concern is justified. Though, this CERTAINLY does not mean that science is atheistic. It merely means that many of the vocal scientists supporting Darwin's theory are atheists who want no part of religion and feel that it is a hindrance to our students to rely on God, in any fashion, rather than scientific evidence. Science, itself, is not the problem.
Humes does mention that Barbara Forrest is part of a humanist group because it came up in the trial, but it he also informs us that Judge Jones says that is not significant to the trial. That is something that I truly do not understand.
Nick Matzke, along with others from the National Center for Science education are praised up one side and down the other while every ID supporter is subjected to an endless string of digs. The religious beliefs of the ID supporters are put under a microscope, yet those on the plaintiffs side are rarely mentioned at all.
Miller (who is the token Christian) is also praised beyond belief, but from where I'm standing this gentleman seems to suffer from an inexplicable extraordinary case of personal credulity. In his mind there is apparently nothing that evolution cannot accomplish and he uses the most simplistic examples to support it and extrapolates them to no end.
There is a reason why people like Bill Buckingham are concerned with the implications of evolution and his concerns are not just in his imagination. If you spend enough time on the Internet and read many of the things said by Darwin's supporters on-line, it becomes increasingly clear that the majority of those who support Darwinism are atheists or strong agnostics. There are exceptions just as there are atheists and agnostics who support design, but in the end, this entire debate centers around an interpretation of the scientific data surrounding the facts about evolution. Philosophical and religious beliefs factor in on one’s interpretation regardless of whether either side cares to admit it or not.
It is reasonably clear that the Dover board members were ignorant to many facts regarding evolution, ID and creation science, and that is unfortunate. If someone is going to take a stand on these issues as they did, it is vitally important to completely understand what you are endorsing.
It also appears that they did lie about using the term "creationism" during board sessions and that is something that cannot be overlooked. It would have been interesting to have been a fly on the wall during those board meetings, because I have no doubt that the Rehms and the science teachers got every bit as nasty as those board members who supported ID. I’ve also seen what the media did to the board members here in Kansas, so I have no doubt that the media did misrepresent the boards actions and their words on various occasions as the board members alluded to.
Sigh...I could go on and on forever as my book is so full of post-it notes it's depressing. But, I’m just too sad about the situation to think about it further right now. I do wonder how Bill Buckingham is faring. He apparently moved away from Dover, and I hope that things are turning around for him. I hate to see people who have gone through so much get beat even further in an ordeal like this. It’s too bad the whole think wasn’t stopped early on to save a lot of heartache for the citizens of Dover.
The book did put a bit of a damper on my usually festive camping mood. It made me feel profoundly sad. This sadness didn't center around the issues in the debate but rather the way in which people treated each other throughout the Dover ordeal. The bitterness, spite, anger, and resentment throughout left me with an awful feeling that I still haven't shaken.
Humes sees only one side of this situation, and that is unfortunate. His descriptions of people throughout were very telling in that every person who did not support Darwinism was painted as a person who was trying to force religion into the schools. There were also negative overtones in regard to their descriptions such as "his eyes burning and birdlike", "something of a loose cannon", "an affable, balding law professor in his sixties with a conspicuous gray comb-over", "the big, bluff animal doctor", or "a young attorney...with a soft, hoarse voice, a pained expression on his face, and a poker hand he didn't seem to relish...". Humes is a master of subtle digs against those who support design, but his description of Miller, Matzke, Scott, Forrest, and the Dover science teachers are glowing, with Miller even being compared to a "rock star". The term "creationism" (whatever that truly is) is painted as a fanatical right wing belief that only those who are ignorant or liars would associate themselves with it.
Poor Bill Buckingham is ripped up one side and down the other by both sides in the debate. I have to wonder if anyone who opposed his judgment on various issues throughout the whole affair ever approached him personally, one on one, just to see how he was feeling. Apparently, if Humes account is correct, during the time he was on the board and supporting ID he was taking OxyContin for an injury, his mother died, his father died, his dog died, two close Uncles died, his closest aunt died and his neighbor's daughter committed suicide (he was the first to find her). He also considered suicide.
Was anyone around for him? Did the science teachers realize this was going on? Did they care? If they did try to help and he wouldn't accept their help, did they voice their concerns to his clergy or someone who he might be comfortable talking with?
Where is the compassion for others? Why don't people listen to one another with respect and consideration for viewpoints that don't exactly jive with their own? How did this situation go to the lengths that it did? Who would sue over a simple paragraph like the one that was approved by the board? And, when the ACLU took up with those parents who were disgruntled, if I had been a board member, I would have just said let's drop the whole thing because it's not worth the trouble. There are better venues in which to approach this growing acceptance of Intelligent Design and perhaps the evolutionists are right in saying that it should not be brought to the schools yet. Because, as we have seen, the Dover science teachers didn't seem to have any more knowledge about the movement than the board members. Teachers in general have no idea what intelligent design is, and they certainly are not familiar with the arguments against Darwinism because they have never had the opportunity to learn about these issues from anyone other than Darwin supporters.
What people refuse to acknowledge is that there are two distinct interpretations of the scientific data when it comes to origins, and to dismiss either is simply wrong. In the end, that is what this all boils down to -- regardless of what anyone will admit. Is there a higher source of intellect responsible for our existence or not, and can we detect the design in nature that this higher source may have been responsible for?
Although Humes would have us believe that those who support ID are ingenuous, ill informed religious extremists, he never mentions much at all about the fact that the majority of those on the other side of this debate are quite hard core in their atheist or agnostic beliefs. He, like Judge Jones, does not find this relevant at all.
Time and time again we are given examples of something that an ID supporter said that would acknowledge that they do believe in God and do hold certain religious beliefs. Although, this has absolutely nothing to do with the science of ID at all, it is the number one consideration in whether the design inference should be considered scientific.
It’s interesting that Humes gives the flamboyant atheist and University of MN biology professor, PZ Myers, this flattering description:
Myers became a one-man wrecking crew, blogging furiously against Bush, Berlinski, Behe, The New York Times, and Discovery, and posting links to research papers and other information that refuted every one of their claims.
Myers is an interesting, dynamic science writer, and his excitement at the revolution going on in his discipline - developmental biology, one of the hottest fields in science - is palpable, as is hi anger at the claims of ID proponents. His is one of the most read personal science blogs on the Internet - Pharyngula.org, which routinely draws 25,000 readers a day - and he uses the platform to talk science, post weekly exotic photos of cephalopods (octopuses), and attack intelligent design incessantly.
He never mentions that right under the title of Myers blog site are these words:
"Evolution, development, and random biological ejaculations from a godless liberal".
Nor does he mentions that Myers has what seems to be a mission to degrade religious thought at every possible opportunity. Some of the categories of his blog include: "godlessness", "kooks", and "creationism", in which he daily rips apart those whose views differ from his own atheistic religious outlook on life. He's harsh, cruel, and unjustly bitter toward religion. I once tried emailing PZ and reasoning with him, but he said something negative and told me he wouldn't respond to any further emails from me. I said nothing disrepectful or nasty, but he refused to even consider my concerns. I was told to go away.
There are many like him involved in this debate and that is why people like Bill Buckingham are concerned. But, Humes considers these concerns somewhat imaginary and that they are merely instigated by people like Kent Hovind. One certainly doesn’t have to listen to Hovind to know that there are many Darwinists out there who reject God. Just surf the Internet for a few days and you'll understand quite quickly that Bill's concern is justified. Though, this CERTAINLY does not mean that science is atheistic. It merely means that many of the vocal scientists supporting Darwin's theory are atheists who want no part of religion and feel that it is a hindrance to our students to rely on God, in any fashion, rather than scientific evidence. Science, itself, is not the problem.
Humes does mention that Barbara Forrest is part of a humanist group because it came up in the trial, but it he also informs us that Judge Jones says that is not significant to the trial. That is something that I truly do not understand.
Nick Matzke, along with others from the National Center for Science education are praised up one side and down the other while every ID supporter is subjected to an endless string of digs. The religious beliefs of the ID supporters are put under a microscope, yet those on the plaintiffs side are rarely mentioned at all.
Miller (who is the token Christian) is also praised beyond belief, but from where I'm standing this gentleman seems to suffer from an inexplicable extraordinary case of personal credulity. In his mind there is apparently nothing that evolution cannot accomplish and he uses the most simplistic examples to support it and extrapolates them to no end.
There is a reason why people like Bill Buckingham are concerned with the implications of evolution and his concerns are not just in his imagination. If you spend enough time on the Internet and read many of the things said by Darwin's supporters on-line, it becomes increasingly clear that the majority of those who support Darwinism are atheists or strong agnostics. There are exceptions just as there are atheists and agnostics who support design, but in the end, this entire debate centers around an interpretation of the scientific data surrounding the facts about evolution. Philosophical and religious beliefs factor in on one’s interpretation regardless of whether either side cares to admit it or not.
It is reasonably clear that the Dover board members were ignorant to many facts regarding evolution, ID and creation science, and that is unfortunate. If someone is going to take a stand on these issues as they did, it is vitally important to completely understand what you are endorsing.
It also appears that they did lie about using the term "creationism" during board sessions and that is something that cannot be overlooked. It would have been interesting to have been a fly on the wall during those board meetings, because I have no doubt that the Rehms and the science teachers got every bit as nasty as those board members who supported ID. I’ve also seen what the media did to the board members here in Kansas, so I have no doubt that the media did misrepresent the boards actions and their words on various occasions as the board members alluded to.
Sigh...I could go on and on forever as my book is so full of post-it notes it's depressing. But, I’m just too sad about the situation to think about it further right now. I do wonder how Bill Buckingham is faring. He apparently moved away from Dover, and I hope that things are turning around for him. I hate to see people who have gone through so much get beat even further in an ordeal like this. It’s too bad the whole think wasn’t stopped early on to save a lot of heartache for the citizens of Dover.
Saturday, March 17, 2007
The Myth of Moral Neutrality

By now, we're all aware of General Pace's comments about homosexuality and the military.
Gregory Koukl (Stand to Reason) considers the myth of moral neutrality in this article. Makes perfect sense, but judging by the comments following the article, this issue is like every other in the culture war. There are two distinct worldviews and neither the twain shall me.
More Monkey Girl
As I continue to read through Monkey Girl, one thing keeps coming to my mind. It seems to me that a huge majority of those who oppose Intelligent Design are much more concerned about doing away with a literal interpretation of biblical history than they are concerned about their interpretation of the scientific evidence. They can’t accept the fact that ID has nothing to do with a literal interpretation of the Bible, though that is the main reason they oppose it.
And, something that really needs to be rectified in this debate is to come up with a much better set of definitions in order to communicate clearly when addressing various issues surrounding the ToE. If pro-evolution scientists really wanted to help people better understand evolution, they would work hard at defining the various aspects of the theory so that people know what in the heck they are talking about. Though, it is very convenient for them at times not to have to break the term down.
Humes wrote on pg. 27:
All this talk about the development of new antibiotics etc. is based on microevolution, which can be empirically tested. ID supporters point this out ad nauseam, but to no avail. Over and over we see these same examples and are warned that our students will “fall hopelessly behind” if we question evolution in any way.
This scare tactic is interesting because ~several~ times throughout the book Humes implies that teachers are scared to death to even broach the subject of evolution in the classroom and that, at present, most of them water it down or don’t teach it at all. So, we should have “fallen hopelessly behind the rest of the world” quite some time ago. But, the truth is that we haven’t. In fact, scientific literacy is on the rise.
I think that if the “scientific community” would lift the ban on allowing discussions about design, both teachers and students would benefit. Teachers wouldn’t have to worry about how they taught evolution if they were allowed to let the students discuss the controversial issues as well. ID doesn’t negate evolution at any level, so the teacher could teach evolution (common ancestry and all) and state that there are those scientists who feel that life is too complex to have evolved through evolutionary mechanisms ~alone~ and go on to explain the inference a bit further. If ID were taught properly, religion wouldn’t be mentioned AT ALL.
Humes goes on to say:
Humes assertion that “many [are] unaware that there is more than one creation story in Genesis alone“ sounds like a Burt Humburg statement (Burt evidently had Humes ear during the Dover trial). He and I went a few rounds regarding his conclusion about Genesis 1&2 some time back in a Kansas forum. Genesis doesn’t have “two” creation stories, but you certainly won’t convince those who are looking for a reason to dismiss scripture to believe that (and, yes, I know that Burt is a theistic evolutionist).
Here is basically what I told Burt:
That is something that irks me. People constantly slam those who support traditional Christianity and a literal interpretation of scripture. But, I hear the craziest things in regard to what a literal interpretation consists of. Evidently, everyone has their own interpretation of what a “literal interpretation” entails, which is another source of conflict in this debate.
Humes does make a very good point with the following comments:
Humes writes:
Okay, I’m rambling so I’ll quit. I was actually going to write about Chapter 9 of Monkey Girl since it focuses around the Kansas science standards. I’ll bet Jeremy is wondering what I thought of that chapter! But, as I was paging through my book, I came across other areas that I had highlighted and got distracted from my goal.
My poor book is almost completely covered in yellow highlighter.
And, something that really needs to be rectified in this debate is to come up with a much better set of definitions in order to communicate clearly when addressing various issues surrounding the ToE. If pro-evolution scientists really wanted to help people better understand evolution, they would work hard at defining the various aspects of the theory so that people know what in the heck they are talking about. Though, it is very convenient for them at times not to have to break the term down.
Humes wrote on pg. 27:
The nearly unanimous opinion of the scientific community is that evolution is the bulwark of modern biology and medical research, from the development of new antibiotics to the fight against cancer, and that America’s next generation of scientists will fall hopelessly behind the rest of the world if evolutionary theory is watered down or banished from our schools. [my emphasis]As I’ve stated several times, I’m darn near convinced that evolution is worthless to science at the macro level and in regard to common ancestry. It is certainly an interesting interpretation, but science could roll along just fine without ever giving it any consideration. The part of the theory that is vital to science is microevolution, which is not being questioned in the least.
All this talk about the development of new antibiotics etc. is based on microevolution, which can be empirically tested. ID supporters point this out ad nauseam, but to no avail. Over and over we see these same examples and are warned that our students will “fall hopelessly behind” if we question evolution in any way.
This scare tactic is interesting because ~several~ times throughout the book Humes implies that teachers are scared to death to even broach the subject of evolution in the classroom and that, at present, most of them water it down or don’t teach it at all. So, we should have “fallen hopelessly behind the rest of the world” quite some time ago. But, the truth is that we haven’t. In fact, scientific literacy is on the rise.
I think that if the “scientific community” would lift the ban on allowing discussions about design, both teachers and students would benefit. Teachers wouldn’t have to worry about how they taught evolution if they were allowed to let the students discuss the controversial issues as well. ID doesn’t negate evolution at any level, so the teacher could teach evolution (common ancestry and all) and state that there are those scientists who feel that life is too complex to have evolved through evolutionary mechanisms ~alone~ and go on to explain the inference a bit further. If ID were taught properly, religion wouldn’t be mentioned AT ALL.
Humes goes on to say:
Yet polls also find that solid majorities of Americans are essentially ignorant of evolutionary theory and the scientific evidence that support it, and are nearly as clueless when it comes to the details of the literal biblical stories of creation (with many unaware that there is more than one creation story in Genesis alone).Sigh...no doubt this is true, but it is also true that even less understand what Intelligent Design is actually about because of the horrendously misleading information being spread by the scientific community.
Humes assertion that “many [are] unaware that there is more than one creation story in Genesis alone“ sounds like a Burt Humburg statement (Burt evidently had Humes ear during the Dover trial). He and I went a few rounds regarding his conclusion about Genesis 1&2 some time back in a Kansas forum. Genesis doesn’t have “two” creation stories, but you certainly won’t convince those who are looking for a reason to dismiss scripture to believe that (and, yes, I know that Burt is a theistic evolutionist).
Here is basically what I told Burt:
Genesis contains two descriptions of creation. The first is chronological, while the second is from man’s perspective (literary). A close study of the Hebrew words shows no conflict. Christ, who in a single sentence mentioned both descriptions, knew they referred to the same creation event. (Mt 19:4-5) Per my footnotes in my NIV Bible: 1:1-2:3 is a general account of creation, while 2:4-4:26 focuses on the beginning of human history. Ch. 2 also sets the stage for the fall. It tells of the scene and circumstances of the fall, supplementing the terse account of man’s creation in ch.1 with only such data as comes into play in the ensuing tragic-drama.But, just because I interpret these two chapters this way doesn’t necessary make me correct beyond all doubt, but Humes certainly cannot assert as fact that there are “two creation accounts” in Genesis. I simply think his reasoning on this point is illogical.
Also, I think everyone would agree that the writers of scripture were not complete idiots. There were approximately 40 writers over a 1,500 year period. Even those who have done a very small amount of biblical research would have to admit that the writers were pretty bright individuals.
Now, having said that, the fact that those 2 chapters are worded the way they are, in my mind, make the chapters all the more convincing. Moses and the other readers would have all caught an “error” like that. I think if chapter 2 was meant to be a chronological account just as chapter 1 was, Moses would have said “Whoa, hold the phone! We can’t have this - people will think we’ve made an error!!! Even Jesus quoted from both of the chapters at the SAME time. (Matthew 19:4-5) You‘d sure think someone would have noticed that there were two creation stories with conflicting facts if they were, in fact, both chronological accounts.
That is something that irks me. People constantly slam those who support traditional Christianity and a literal interpretation of scripture. But, I hear the craziest things in regard to what a literal interpretation consists of. Evidently, everyone has their own interpretation of what a “literal interpretation” entails, which is another source of conflict in this debate.
Humes does make a very good point with the following comments:
It would not occur to the organizers of “Steeling the Mind” (anti-evo. group) to invite an evolutionary biologist to the conference so that attendees could hear a different perspective, just as it would not occur to the organizers of the annual conference of the National Science Teachers Association, which met a few weeks later in the same vicinity, to invite a panel of creationists to join one of it’s sixteen separate sessions on teaching evolution and dealing with related controversies in public schools.No kidding. Everyone preaches to the choir, but the ID side is certainly more open to public debate than those who support evolution. I do not support creation science being taught in the schools, but I do like Walt Brown‘s (a creation scientist) idea of a written debate which would cover all aspects of science that surrounds this controvery. That would be facinating, and since most people have already been conned into thinking that ID is creation science, let’s get a good solid debate that would help put many of these questions to rest for those of us who are interested.
Humes writes:
One speaker at “Steeling the Mind” put it this way: “Kids go off to college and give up on God. Start worrying less about where your kids are going to go to college, and send them to a Christian school now”. A young man in the audience turned that concern on its head, admitting that he preferred to bank on ignorance: “I’m really afraid to learn too much about evolution, because it might make me doubt my religion. And then where would I be? What would I tell my family? My girlfriend?”Boy, ain’t that the truth. Some religious folks don’t want to “get confused” so they stick their head in the sand and never think about things that they fear might lead them to doubt their faith. I’ve known people like this, and I find it absolutely ridiculous to have such an attitude. How in the world will you know if your faith is worth fighting for or sharing with others if you don’t thoroughly search for truth at every turn? It blows my mind that more people aren’t searching diligently for answers in regard to human origins, and many of those answers focus on science and theology. If there is a designer, what was his purpose in designing this vast universe? Merely a whim? If no designer exists, how in the devil did we evolve from virtually nothing? Logically, there has to be a designer of some sort, and it seems illogical that our universe was based on nothing more than a whim. That is where religion comes in, and those who never study various religions or consider the supporting evidence for each are really missing out on an extraordinary journey. My Christian faith has been strengthened immensely by jumping out of the comfort zone.
Okay, I’m rambling so I’ll quit. I was actually going to write about Chapter 9 of Monkey Girl since it focuses around the Kansas science standards. I’ll bet Jeremy is wondering what I thought of that chapter! But, as I was paging through my book, I came across other areas that I had highlighted and got distracted from my goal.
My poor book is almost completely covered in yellow highlighter.
Atheists & Theists
A poster with the screen name “human being” brought up some interesting points, and since he/she seems to have an in with humanist groups perhaps I can learn a few things from her/him about how to address some of these issues.
HB wrote:
A couple things...
Number one, it seems to me that a contest like this would provoke regardless of how it was set up. I think the group responsible for this probably knew that. What was gained by the contest? What was the objective besides trying to find a high ranking atheist in government? These are serious questions. I’m not trying to mess with you in any way.
I do understand your concern about being marginalized, and as a Christian I’m not sure how to help. That is one reason why I wrote this post. I think there are two extreme sides in this problem, and I don’t think they include the majority of Christians or Atheists. Yet, their voices are the ones we hear and they get us riled up at times. I do not support treating atheists differently than anyone else. As far as electing a person without faith in God into a government office, it would depend upon the person. I know people who do not believe in God, but they aren’t involved in groups in which the objective is to denigrate religious beliefs. They have no interest in reaching others with their “rational” approach to religious thought. I would be leary of voting for those involved in the type of groups in which the objective is to do away with religious thought and replace it with what ~they~ deem as “rational” (a godless worldview).
Now, on the flip side, I would never vote for a guy like Pat Robertson because as a Christian I don’t think it is appropriate to try to infiltrate government in order to ensure that we live in a “Christian nation”. Christ was never about running an earthly government, and absolutely nothing good can come from a theocracy - nothing AT ALL.
But, on the other hand, if two people are running for a government seat, and one is pushing an agenda that doesn’t jive with my worldview and beliefs about what is best for our nation, then I’m going to have to vote with my heart on the issue. Most of the time that would probably put me in line with those nominees who are conservative, and they probably have a religious background.
I do know something about the feeling of being a minority. I’ve been posting on line for several years now in regard to the ID/evolution debate, and I find myself being talked down to, called names, etc. etc.. Many times I think I should just give up because it‘s useless to try to get people to understand my point of view, and it‘s not fun being told over and over that your views are so insignificant that, as a person, I don‘t deserve even an inkling of respect.
So, no, it’s not fun when your beliefs or disbeliefs are dismissed before you even get a chance to speak. Obviously we would all like people to understand and accept our viewpoints, although I’ve learned that everyone is much better off if they don’t push their beliefs on others. We need to accept each other for what we are, leave the lines of communication wide open, and try to make concessions when possible.
Here is where I think there is a difference between atheists who are quite pushy in their godless beliefs and atheists who simply don’t make such a big deal about it. For instance, say that PZ Myer and Pat Robertson were running for a position in government. Now, I would never vote for either one of them to any government position because they are loud, unbending, and simply don’t consider the feelings of others when they say the things they do.
I think this is why I feel defensive in regard to those who are involved with humanist and atheist groups. From what I read on their websites and discussion boards, their main objective is to degrade anything that they feel is associated with religious thought. I don’t think that mainstream religious groups focus on degrading atheists. They seem to focus more on how we find meaning for our lives from God’s word, how to help and treat others, and how to share our faith in a positive way (without ridicule). Certainly there are Christians who are nasty toward atheists, but I don’t think that is the norm.
As individuals, I look at atheists as equal in every way. I have friends who are atheist or agnostic and I certainly don’t treat them any differently than anyone else. But, I am very leery of atheist groups because they have an agenda that I’m not comfortable with, and since we can no longer discuss scripture in schools and have little time between all the extra activities our children are involved in, it is a worry that our kids won’t have the opportunity to learn enough about scripture in order for them not be influenced by these growing groups of proud & loud godless people. That is why I am involved in teaching a church group of teens ~why~ we, as Christians, believe what we do rather than telling them what to believe and to rely on their faith alone.
Anyway, I’m not sure how to be “tolerant” of these groups because they seem so completely “intolerant” of my views as a Christian. Any suggestions?
I know you feel that you are in a minority, but as a Christian I also feel that we get our share of bashing as well. I’m a conservation, traditional Christian and maybe I’m too entrenched in this debate to have a good perspective on this issue anymore, but it seems to me that people consider me a “bigot”, a “liar for Jesus”, “intolerant”, etc. quite frequently merely because I am a Christian and hold a certain worldview. The cry from the left is louder than ever and we had taken the bible and prayer out of schools, the ten commandments need to be hidden from view, and I’m sure it’s only a matter of time before the pledge and our currency drop that dreaded word “God”. It’s sad, IMO, and the fact that some groups are fighting so hard to get rid of what so many of us hold dear only stirs up the heat.
In my opinion, you are quite wrong in your assessment. Why are liberal theists and atheists given the luxury of being without blame of stirring things up? Why aren’t people who have strong religious beliefs allowed to voice their concerns and opinions? How are their strong beliefs wrong and your strong beliefs right? You might think that that the right doesn‘t want to allow you a voice, but on the other hand, you seem to be saying that those with strong religious beliefs should not be allowed a voice. Do you understand that there are problems coming from both directions?
I’m curious what you thought about the blasphemy challenge. Was that something that you felt was productive to this culture war we seem to find ourselves in?
I think we all need to take part of the blame and try desperately to find a way to make things better. I’ll be very honest in saying I don’t have any idea how to accomplish that, but maybe others might have some idea.
Anyway, thanks for posting...it gave me something to think about.
HB wrote:
Actually, the Secular Coalition of America (the ONLY lobbyist group for nonbelievers) had a contest to try and find a high ranking atheist in government. They weren't even sure if they would find one.
I think they were hoping to find one with enough courage (I'm sure it took a GREAT deal of courage for Rep. Stark to come out) to publicly declare their non-belief. In this country, it is political suicide to actually declare your true beliefs, if they are atheistic. Because when you do, you're completely marginalized, and not allowed to be a part of the government. And christians claim this is a free country???
A couple things...
Number one, it seems to me that a contest like this would provoke regardless of how it was set up. I think the group responsible for this probably knew that. What was gained by the contest? What was the objective besides trying to find a high ranking atheist in government? These are serious questions. I’m not trying to mess with you in any way.
I do understand your concern about being marginalized, and as a Christian I’m not sure how to help. That is one reason why I wrote this post. I think there are two extreme sides in this problem, and I don’t think they include the majority of Christians or Atheists. Yet, their voices are the ones we hear and they get us riled up at times. I do not support treating atheists differently than anyone else. As far as electing a person without faith in God into a government office, it would depend upon the person. I know people who do not believe in God, but they aren’t involved in groups in which the objective is to denigrate religious beliefs. They have no interest in reaching others with their “rational” approach to religious thought. I would be leary of voting for those involved in the type of groups in which the objective is to do away with religious thought and replace it with what ~they~ deem as “rational” (a godless worldview).
Now, on the flip side, I would never vote for a guy like Pat Robertson because as a Christian I don’t think it is appropriate to try to infiltrate government in order to ensure that we live in a “Christian nation”. Christ was never about running an earthly government, and absolutely nothing good can come from a theocracy - nothing AT ALL.
But, on the other hand, if two people are running for a government seat, and one is pushing an agenda that doesn’t jive with my worldview and beliefs about what is best for our nation, then I’m going to have to vote with my heart on the issue. Most of the time that would probably put me in line with those nominees who are conservative, and they probably have a religious background.
I do know something about the feeling of being a minority. I’ve been posting on line for several years now in regard to the ID/evolution debate, and I find myself being talked down to, called names, etc. etc.. Many times I think I should just give up because it‘s useless to try to get people to understand my point of view, and it‘s not fun being told over and over that your views are so insignificant that, as a person, I don‘t deserve even an inkling of respect.
So, no, it’s not fun when your beliefs or disbeliefs are dismissed before you even get a chance to speak. Obviously we would all like people to understand and accept our viewpoints, although I’ve learned that everyone is much better off if they don’t push their beliefs on others. We need to accept each other for what we are, leave the lines of communication wide open, and try to make concessions when possible.
And the reason the SCA and the AHA made such a big deal about it was not to piss off the radical right, but to loudly acknowledge that there really truly is a nonbelieving government official.
All that the SCA and the AHA and any other atheist wants is to have fair access to the political process (be able to run for any office regardless of our religious beliefs), to be recognized as equals rather always cast as immoral, basically to be treated as human beings.
Here is where I think there is a difference between atheists who are quite pushy in their godless beliefs and atheists who simply don’t make such a big deal about it. For instance, say that PZ Myer and Pat Robertson were running for a position in government. Now, I would never vote for either one of them to any government position because they are loud, unbending, and simply don’t consider the feelings of others when they say the things they do.
I think this is why I feel defensive in regard to those who are involved with humanist and atheist groups. From what I read on their websites and discussion boards, their main objective is to degrade anything that they feel is associated with religious thought. I don’t think that mainstream religious groups focus on degrading atheists. They seem to focus more on how we find meaning for our lives from God’s word, how to help and treat others, and how to share our faith in a positive way (without ridicule). Certainly there are Christians who are nasty toward atheists, but I don’t think that is the norm.
This is not about both sides doing the wrong things. Yes, atheists sometimes do and say wrong things as well. But the bulk of the problem is the oppression of the atheist viewpoint in all things culturally, socially, and politically. Once atheists are recognized as equals, then things can improve.
As individuals, I look at atheists as equal in every way. I have friends who are atheist or agnostic and I certainly don’t treat them any differently than anyone else. But, I am very leery of atheist groups because they have an agenda that I’m not comfortable with, and since we can no longer discuss scripture in schools and have little time between all the extra activities our children are involved in, it is a worry that our kids won’t have the opportunity to learn enough about scripture in order for them not be influenced by these growing groups of proud & loud godless people. That is why I am involved in teaching a church group of teens ~why~ we, as Christians, believe what we do rather than telling them what to believe and to rely on their faith alone.
Anyway, I’m not sure how to be “tolerant” of these groups because they seem so completely “intolerant” of my views as a Christian. Any suggestions?
For example, all Rep. Stark did was publicly declare he is a nonbeliever. Not really a big deal. I read one article that went from this innocent statement to saying that atheists are keeping children from praying in schools and liberals are bashing christians all the time. They then went further and suggested that all congress officials declare publicly their beliefs for all to hear (and judge, IMO). All Rep. Stark said was what he believed about god. Why is this so terrible? And why is it so terrible to celebrate it and put the word out there?
I know you feel that you are in a minority, but as a Christian I also feel that we get our share of bashing as well. I’m a conservation, traditional Christian and maybe I’m too entrenched in this debate to have a good perspective on this issue anymore, but it seems to me that people consider me a “bigot”, a “liar for Jesus”, “intolerant”, etc. quite frequently merely because I am a Christian and hold a certain worldview. The cry from the left is louder than ever and we had taken the bible and prayer out of schools, the ten commandments need to be hidden from view, and I’m sure it’s only a matter of time before the pledge and our currency drop that dreaded word “God”. It’s sad, IMO, and the fact that some groups are fighting so hard to get rid of what so many of us hold dear only stirs up the heat.
The radical religious right is the problem, not the liberal theists, and not the atheists.
In my opinion, you are quite wrong in your assessment. Why are liberal theists and atheists given the luxury of being without blame of stirring things up? Why aren’t people who have strong religious beliefs allowed to voice their concerns and opinions? How are their strong beliefs wrong and your strong beliefs right? You might think that that the right doesn‘t want to allow you a voice, but on the other hand, you seem to be saying that those with strong religious beliefs should not be allowed a voice. Do you understand that there are problems coming from both directions?
I’m curious what you thought about the blasphemy challenge. Was that something that you felt was productive to this culture war we seem to find ourselves in?
I think we all need to take part of the blame and try desperately to find a way to make things better. I’ll be very honest in saying I don’t have any idea how to accomplish that, but maybe others might have some idea.
Anyway, thanks for posting...it gave me something to think about.
Friday, March 16, 2007
Further ridicule...apparently their best defense
Quite disheartening.
Name calling and put downs coming from the Darwinists are par for the course. I see it on an hourly basis.
It does have an affect, and truth be told, if I'd only listened to the media and never dug any deeper, I'd have caved to the rhetoric myself. When you hear people refering to ID supporters as morons and idiots long enough, you tend to believe it.
But, this approach will be the Darwinists undoing in the end. There is no doubt about that.
Name calling and put downs coming from the Darwinists are par for the course. I see it on an hourly basis.
It does have an affect, and truth be told, if I'd only listened to the media and never dug any deeper, I'd have caved to the rhetoric myself. When you hear people refering to ID supporters as morons and idiots long enough, you tend to believe it.
But, this approach will be the Darwinists undoing in the end. There is no doubt about that.
Thursday, March 15, 2007
More on HPV vaccine
Okay, I've read enough now to change my opinion about this vaccine. At first I was all for it, but after reading about it more thoroughly, I've changed my mind. If I had a teen daughter, she would not be getting this vaccine yet.
Here's another article to consider.
Here's another article to consider.
A researcher who worked on a vaccine for the human papillomavirus is warning that it hasn't been tested on young girls, is "silly" for states to mandate the vaccination, and in a worst-case scenario could even increase cervical cancer rates.At a cost estimated at $360-$400 per child, Merck's gonna made a bundle if they can get the government to mandate the vaccine.
In a report published by the Indiana-based Daily News, researcher Diane M. Harper said giving such a vaccine to 11-year-olds "is a great big public health experiment."
Further, she said, requiring vaccinations now "is simply to Merck's benefit."
Wednesday, March 14, 2007
DNA-O-Gram
My sixth grade son is learning about DNA in science class this semester. His teacher showed them this cute little DNA-O-Gram website.
Here is a strand of DNA for you to decode:
AAGGGCGCTGCTGGCGGAATGCGTGGACTCCTTGTCGTTGTATC
AATGGATGTCATGCGTATGGAACGTGTACTCCTT
[Make sure there is no space between the C in the first line and the A in the second when you decode it.]
Here is a strand of DNA for you to decode:
AAGGGCGCTGCTGGCGGAATGCGTGGACTCCTTGTCGTTGTATC
AATGGATGTCATGCGTATGGAACGTGTACTCCTT
[Make sure there is no space between the C in the first line and the A in the second when you decode it.]
Godless coins

Atheists should like this bit of news. The first George Washington dollars in circulation were without the words "In God We Trust".
Evidently a flaw.
My sister actually got a hold of some of these coins and gave me one. Sure enough, no mention of God on those suckers.
I don't know what the big deal is about those four words, but it sure antagonizes certain groups. I'm almost at the point where I don't care whether the phrase is put on coins or not. Why raise such a ruckus about words that were not even originally on the coins? Sometimes little issues like this can cause more harm to Christianity than good. Of course, the majority of Americans trust in God, but do we have to put it on our money to prove that point? Our actions toward others is much more important than four words on a coin.
Pro-homosexuality discussions in our schools?
My youngest is in fourth grade this year, and tomorrow he is watching his first in-class sex ed film.
He wanted to “opt-out”....LOL.
I told him he’d have to grin and bear it because he’s going to have to sit through it. He’s a bit more modest than my oldest. #1 never even tells me when the films are going to be shown, and they don’t seem to phase him in the least, as he says “I already know all that stuff”. #2 doesn’t want any part of it, and thinks it’s “stupid”.
Well, at least they aren’t pushing pro-homosexual discussions in our school (yet). Or, at least I hope they aren’t! It seems that a high school in IL required their 14-year-old freshman to:
Sheesh...I’m still not sure I believe this story.
He wanted to “opt-out”....LOL.
I told him he’d have to grin and bear it because he’s going to have to sit through it. He’s a bit more modest than my oldest. #1 never even tells me when the films are going to be shown, and they don’t seem to phase him in the least, as he says “I already know all that stuff”. #2 doesn’t want any part of it, and thinks it’s “stupid”.
Well, at least they aren’t pushing pro-homosexual discussions in our school (yet). Or, at least I hope they aren’t! It seems that a high school in IL required their 14-year-old freshman to:
...attend a "Gay Straight Alliance Network" panel discussion led by "gay" and "lesbian" upperclassmen during a "freshman advisory" class which "secretively featured inappropriate discussions of a sexual nature in promotion of high-risk homosexual behaviors."And, they were told to sign a confidentiality agreement promising not to tell their parents.
Sheesh...I’m still not sure I believe this story.
Not sure what to think...
I hate posting anything that I think might be considered a scare tactic, but I'm not sure what the Christian response should be to some issues. So, I'm going to post this and maybe someone can make some suggestions as to how to respond to this type of stuff.
There is a growing trend among atheists to become evangelists for their faith beliefs. I seriously don't have a problem with atheists voicing their opinions and concerns about religion if they do so in a respectful manner. Likewise, I have a huge problem with theists who are disrespectful to atheists merely because their beliefs differ from their own.
But, I'm not sure what to think about this growing trend among atheist groups to stamp out religious thought altogether.
Richard Dawkins wrote in his book, The God Delusion:
We also we find Internet groups, such as The Rational Response Squad that has been quite provocative in their approach. They seem to focus on calling young people to the flock.
My biggest worry is that theists are pushing these type of groups by being so intolerant of their opinions. Atheists should be given a voice, and if theists cannot embrance and try to understand their concerns in a respectful manner, are we actually pushing them to become so angry and bitter about our religious views that they want do away with religion altogether? I'm sure that all the talk about Intelligent Design has them concerned about their naturalistic views being threatened as well.
I think the key to raising our children in the Christian faith is to be sure that we teach them ~why~ we believe what we do rather than only teaching them ~what~ we believe. Apologetics is a necessity in our churches today, and I've been encouraged lately in seeing that many churches are considering the evidence that supports what we believe rather than relying on blind faith.
There is a growing trend among atheists to become evangelists for their faith beliefs. I seriously don't have a problem with atheists voicing their opinions and concerns about religion if they do so in a respectful manner. Likewise, I have a huge problem with theists who are disrespectful to atheists merely because their beliefs differ from their own.
But, I'm not sure what to think about this growing trend among atheist groups to stamp out religious thought altogether.
Richard Dawkins wrote in his book, The God Delusion:
I am attacking God, all gods, anything and everything supernatural, whatever and whenever they have been or will be invented.He and Sam Harris seem to the Billy Grahams of this crusade, and the big problem is that they use science as their sword. Seven atheist and secular organizations recently established the Secular Coalition for America, which seems to be centered on seeking to eliminate what they consider to be religious favoritism in public policy.
We also we find Internet groups, such as The Rational Response Squad that has been quite provocative in their approach. They seem to focus on calling young people to the flock.
My biggest worry is that theists are pushing these type of groups by being so intolerant of their opinions. Atheists should be given a voice, and if theists cannot embrance and try to understand their concerns in a respectful manner, are we actually pushing them to become so angry and bitter about our religious views that they want do away with religion altogether? I'm sure that all the talk about Intelligent Design has them concerned about their naturalistic views being threatened as well.
I think the key to raising our children in the Christian faith is to be sure that we teach them ~why~ we believe what we do rather than only teaching them ~what~ we believe. Apologetics is a necessity in our churches today, and I've been encouraged lately in seeing that many churches are considering the evidence that supports what we believe rather than relying on blind faith.
Tuesday, March 13, 2007
Casey critiques Sean Carroll
Casey Luskin has offered his review of Carroll's book, The Making of the Fittest. Perfect timing for me as I just recently attended Carroll's lecture at KSU. You can find my review of that lecture here.
Casey points out various issues that I have been thinking about since the lecture, and he is far more articulate than I am. So, be sure to read his review.
I've not read Carroll's book yet, but after listening to his lecture, I'd be willing to bet big bucks that Casey's conclusion is quite accurate:
Casey points out various issues that I have been thinking about since the lecture, and he is far more articulate than I am. So, be sure to read his review.
I've not read Carroll's book yet, but after listening to his lecture, I'd be willing to bet big bucks that Casey's conclusion is quite accurate:
The ID-proponent who reads this book will feel very encouraged about the strength of her own position, for Carroll failed to provide any compelling explanations for the primary subject of his book: the evolutionary making of the fittest.
Monday, March 12, 2007
Dr. Egnor joins Evolution News & Views
Recently, I wrote about pro-ID neurosurgeon Michael Egnor. He had been posting on various blogs in response to an article written by a journalist for Time magazine. His comments were quite insightful, and they brought me back to wondering ~again~ why biologists act as if evolutionary biology is the only answer to how human life arose.
I’ve also wondered why evolutionary biologists maintain that common descent is so vital to science. This comment thread provides some of my thoughts as to why I don’t believe science would have suffered at all if common descent had never been taken seriously.
It looks as though Dr. Egnor will now be writing for Evolution News & Views. He’ll be a great addition to their team.
In his first article, he writes in regard to the high school essay contest sponsored by the folks at Alliance for Science. His article further solidifies my thoughts about the necessity of macroevolution.
Here are a few thoughts from the article:
Interesting...
I’ve also wondered why evolutionary biologists maintain that common descent is so vital to science. This comment thread provides some of my thoughts as to why I don’t believe science would have suffered at all if common descent had never been taken seriously.
It looks as though Dr. Egnor will now be writing for Evolution News & Views. He’ll be a great addition to their team.
In his first article, he writes in regard to the high school essay contest sponsored by the folks at Alliance for Science. His article further solidifies my thoughts about the necessity of macroevolution.
Here are a few thoughts from the article:
Doctors don’t study evolution. Doctors never study it in medical school, and they never use evolutionary biology in their practice. There are no courses in medical school on evolution. There are no ‘professors of evolution’ in medical schools. There are no departments of evolutionary biology in medical schools.
...I am a professor of neurosurgery, I work and teach at a medical school, I do brain research, and in 20 years I’ve performed over 4000 brain operations. I never use evolutionary biology in my work. Would I be a better surgeon if I assumed that the brain arose by random events? Of course not. Doctors are detectives. We look for patterns, and in the human body, patterns look very much like they were designed. Doctors know that, from the intricate structure of the human brain to the genetic code, our bodies show astonishing evidence of design. That’s why most doctors—nearly two-thirds according to national polls—don’t believe that human beings arose merely by chance and natural selection. Most doctors don’t accept evolutionary biology as an adequate explanation for life. Doctors see, first-hand, the design of life.
...Without using evolutionary theory, doctors and scientists have discovered vaccines (Jenner, in the 18th century, before Darwin was born), discovered that germs cause infectious diseases (Pasteur, in the 19th century, who ignored Darwin), discovered genes (Mendel, in the 19th century, who was a priest and not a supporter of Darwin’s theory), discovered antibiotics, and unraveled the secrets of the genetic code (the key to these discoveries was the discovery of the apparent design in the DNA double helix). Heart, liver, and kidney transplants, new treatments for cancer and heart disease, and a host of life-saving advances in medicine have been developed without input from evolutionary biologists.
Interesting...
Weigh in Week 10, March 12

We've completed week 10, with our total weight loss at 72 lbs..
Dieters, please use the comment section to post how much you lost (or gained) this week, and your ~total~ weight loss since day 1 of dieting. When everyone has done so, I’ll post the results.
UPDATE
Starving -1 this week, -21 total
Davescot -4, -18
Sparky -1, -12
Ftk -2, -12
Gigi -1, -8
Carb Princess -0, -5
Chunky Monkey -0, -5
Manna -1, -1
Find previous diet links below:
Week 9
Week 8
Week 7
Week 6
Sunday, March 11, 2007
Dire Predictions about Global Warming
Scientists are getting frantic over global warming.
Hmmm... something seems weird about all of this. I've been pretty much riding the fence on this global warming thing. The evidence, of course, seems to indicate that we are experiencing global warming, but when scientists start pushing something this hard, I start to wonder what is motivating it other than concern for our well being.
Something is amiss.
The harmful effects of global warming on daily life are already showing up, and within a couple of decades hundreds of millions of people won't have enough water, top scientists will say next month at a meeting in Belgium.
At the same time, tens of millions of others will be flooded out of their homes each year as the Earth reels from rising temperatures and sea levels, according to portions of a draft of an international scientific report obtained by The Associated Press.
Tropical diseases like malaria will spread. By 2050, polar bears will mostly be found in zoos, their habitats gone. Pests like fire ants will thrive.
For a time, food will be plentiful because of the longer growing season in northern regions. But by 2080, hundreds of millions of people could face starvation, according to the report, which is still being revised.
Hmmm... something seems weird about all of this. I've been pretty much riding the fence on this global warming thing. The evidence, of course, seems to indicate that we are experiencing global warming, but when scientists start pushing something this hard, I start to wonder what is motivating it other than concern for our well being.
Something is amiss.
Saturday, March 10, 2007
Regarding comments
If your comment has not shown up, don't get ticked off. I'm extremely busy this weekend, but I've noticed that there are several very good comments that I hope to let past moderation.
BUT, I don't want to do that without taking time to respond to them. I hate letting stuff go by that I disagree with when I don't have time to comment on it. Drives me nuts...
BUT, I don't want to do that without taking time to respond to them. I hate letting stuff go by that I disagree with when I don't have time to comment on it. Drives me nuts...
Friday, March 09, 2007
Billions of Missing Links: A Rational Look at the Mysteries Evolution Can't Explain

This book certainly looks interesting. Of course, evolutionists tell us that these "missing links" are not a problem and that we have sufficient evidence for transitionals between species.
From the explanations I've heard, I think they have a great imagination...
Thursday, March 08, 2007
Not a fun birthday
I got the stomach flu on my birthday....unbelievable. It knocked me out for 24 hours.
I guess the upside is that I should kick butt when we weigh in on Monday, but I can certainly think of much better ways to go about losing weight.
I'll get a chance to celebrate my birthday again this weekend, so hopefully I'll be feeling much better by then.
I guess the upside is that I should kick butt when we weigh in on Monday, but I can certainly think of much better ways to go about losing weight.
I'll get a chance to celebrate my birthday again this weekend, so hopefully I'll be feeling much better by then.
Tuesday, March 06, 2007
A Funny e-Card
I have a good friend who I met a couple years ago in the same forum where I met my twin. He's a physicist who is pro-evolution, but he has the best attitude about these debate issues. Though he is quite firm about his stance on common descent, he doesn't talk down to me, is respectful, and listens as well as provides the opposing viewpoint without getting nasty about it.
It's really too bad that there aren't more scientists like him out there, because if there were, all this intense bickering would be non-existent. He's also got a heck of a sense of humor, which is always helpful when discussing these issues that tend to fire people up fairly easily.
Anyway, I always refer to him as monkey boy because somewhere he picked up this crazy idea that he's a distant relative to those tree swingers.
Check out the card he sent me for my birthday.
It's really too bad that there aren't more scientists like him out there, because if there were, all this intense bickering would be non-existent. He's also got a heck of a sense of humor, which is always helpful when discussing these issues that tend to fire people up fairly easily.
Anyway, I always refer to him as monkey boy because somewhere he picked up this crazy idea that he's a distant relative to those tree swingers.
Check out the card he sent me for my birthday.
What are the odds?
Today is my birthday, so I’m going to tell a bizarro world birthday story. Btw, it’s a true story...
A little over a year ago, I was spending ~a lot~ of time in a pro-evolution Internet forum. The people and the subjects discussed were fascinating, and I found myself trying to figure out what made these people tick. I wondered what it was that causes some of us to hold such astoundingly different views about life, religion, science, politics, etc.
Considering various worldviews and how people form their beliefs, priorities, and values in life is quite interesting, IMO.
Anyway, the majority of individuals posting in this particular forum held agnostic or atheist faith beliefs. Being a Christian, as well as supporting ID, definitely put me in a very small minority.
Well, one evening I was thinking about the atheists in this group. Most of them didn’t think much of me, and many of them treated me with utter distain. But, one of them stood out because regardless of how much he disagreed with my position on various matters, he always treated me with respect.
I decided I’d private message him and ask him some questions about atheism and see if he’d be willing to talk about how he decided to take that path. Sometimes I’m too curious about people I talk to on-line, and they get put off with me, but this guy opened up right away and we had a very interesting discussion.
We found out that our upbringing was quite similar, and we were both brought up in the Lutheran Church. As the conversation continued, we kept finding more similarities between us, and then he told me in passing how old he was. I said “Wow, I’m exactly the same age as you are”. I also said, “Now, if you tell me your birthday is in March, that would be kinda freaky”.
Well, his next message was simply this:
“I was born March 6, 1965.”
I just about had a freaking heart attack on the spot. He was my twin!! We figured the odds of that happening were about 1:14,600.
Pretty crazy if you ask me. I kinda lost track of him since I’ve left that particular forum, but he was a nice guy, and I really appreciated the fact that he treated me kindly regardless of the fact that we disagreed on many issues. I hope he has a great birthday. I sure plan to!!
A little over a year ago, I was spending ~a lot~ of time in a pro-evolution Internet forum. The people and the subjects discussed were fascinating, and I found myself trying to figure out what made these people tick. I wondered what it was that causes some of us to hold such astoundingly different views about life, religion, science, politics, etc.
Considering various worldviews and how people form their beliefs, priorities, and values in life is quite interesting, IMO.
Anyway, the majority of individuals posting in this particular forum held agnostic or atheist faith beliefs. Being a Christian, as well as supporting ID, definitely put me in a very small minority.
Well, one evening I was thinking about the atheists in this group. Most of them didn’t think much of me, and many of them treated me with utter distain. But, one of them stood out because regardless of how much he disagreed with my position on various matters, he always treated me with respect.
I decided I’d private message him and ask him some questions about atheism and see if he’d be willing to talk about how he decided to take that path. Sometimes I’m too curious about people I talk to on-line, and they get put off with me, but this guy opened up right away and we had a very interesting discussion.
We found out that our upbringing was quite similar, and we were both brought up in the Lutheran Church. As the conversation continued, we kept finding more similarities between us, and then he told me in passing how old he was. I said “Wow, I’m exactly the same age as you are”. I also said, “Now, if you tell me your birthday is in March, that would be kinda freaky”.
Well, his next message was simply this:
“I was born March 6, 1965.”
I just about had a freaking heart attack on the spot. He was my twin!! We figured the odds of that happening were about 1:14,600.
Pretty crazy if you ask me. I kinda lost track of him since I’ve left that particular forum, but he was a nice guy, and I really appreciated the fact that he treated me kindly regardless of the fact that we disagreed on many issues. I hope he has a great birthday. I sure plan to!!
Monday, March 05, 2007
He's at it again...

Sam Harris is still urging the scientific community to wage war against religion. You can read the article for yourself. I’m not in the mood to think about Harris today.
Sunday, March 04, 2007
Weigh-in week 9, March 5

We've completed week 9, with our total weight loss at 67 lbs..
Looks like we've made it past the Valentine's Day sweets and the arrival of Girl Scout cookies, so let's see how we did this week.
Dieters, please use the comment section to post how much you lost (or gained) this week, and your ~total~ weight loss since day 1 of dieting. When everyone has done so, I’ll post the results.
UPDATE
Starving -2 this week, -20 total
Davescot -1, -14
Sparky -1, -11
Ftk +1, -10
Gigi -1, -7
Carb Princess -0, -5
Chunky Monkey -0, -5
Manna +2, +2
Week 8
Week 7
Week 6
Week 5
Week 4
Week 3
Week 2
Week 1
start up
Saturday, March 03, 2007
The Making of the Fittest
I mentioned in an earlier post that I attended Sean Carroll's lecture at KU Thursday night. He is a Professor of Molecular Biology, Genetics and Medical Genetics at Wisconsin University-Madison. He is also the author of a few books on evolutionary biology.
Carroll did a fine job of explaining the mechanisms of evolution, and he used some interesting creatures to provide examples of the process.
I think the Ice Fish example was my favorite. I have heard of this fish, but I had never seen pictures of it. It has a transparent, pale looking appearance which is due to the interesting fact that it’s blood is colorless, and cells are present in only 1% of it’s blood. They completely lack red blood cells making it unique in comparison to other vertebrates. Due to the extreme cold water in their habitat in the South Atlantic Ocean, this adaptation has made it easier for them to pump blood thru their capillaries.
Carroll gives an account of how this particular fish adapted to it’s environment through evolutionary processes. He explains how, through dramatic environmental changes that took place over millions of years, the ice fish evolved in order to adapt to these changes and their DNA record can tell us a bit about their history.
He explained how the DNA record can tell us what was lost, modified, and gained through evolutionary mechanisms of this fish and other creatures as well.
A key loss was their globin genes. In other Antarctic fish, there are two globin genes located in their DNA which account for their red blood cells. But, in the Ice Fish, there is only a remnant of one of these genes left. So, although they have had an entire loss of red-blood cells, there is this remnant part of the gene which accounts for red blood cells we find in other fish, yet it has no function in the Ice Fish and is left “rotting” within their DNA.
Then there is a modification to their tubulin genes which has aided in adaptation to the cold habitat they live in, and a key invention (gain) would be an antifreeze gene which arose from preexisting DNA code.
Carroll tells us that the DNA record shows how species are created and that earth and life evolved together. Shifts in lifestyle are reflected in DNA of pertinent genes, and Darwin's principles of natural selection aid in these changes.
He gave various examples of how natural selection works. One was an example of the change in uniform color of soldiers throughout early history. British at one time wore bright red uniforms which were easily spotted by the enemy, and rather than lose more soldiers to a fashion statement, they resorted to khaki uniforms in order to blend in to their environment. Obviously, the khaki would aid in self preservation.
Then he mentioned the rock pocket mouse, which was a favorite of Eugenie Scott’s when she lectured here at KU a few months ago. This little mouse seems to be their replacement to the famous Peppered Moth example.
Carroll explained that there is one single gene (Mc1r) that accounts for these mice being either black or khaki. Obviously, if their habitat is dark in color such as the Pinacate lava flow in Arizona those mice that are black will survive due to the fact that they blend in with their environment and are difficult for owls or other predators to see. Those that were khaki would not survive to pass on their genes and therefore, the black mice would become the prevalent mice in the area. The opposite would occur in a habitat that blended with the khaki mice coloring - their genes would pass on to their offspring and you would find a greater number of khaki mice in the area.
He also gave example of gene differences which affect the opsin in birds and fish and how mutations that occur will be advantagous for certain animals in their particular habitat, and the cause of it is merely a mutation in their gene that is passed down. If the capability is no longer needed or used, it may mutate further and it would be no loss or gain because it is no longer needed.
For example, the clown fish has a perfect opsin gene. This works well for this little fish in it’s bright and colorful environment. But, the coelacanth has 4 mutations to it’s opsin gene which disrupts it’s vision. Considering it’s deep sea environment, these mutations don’t hinder it’s lifestyle.
That pretty much wrapped up the evidence he gave for evolution. I can't say that I have much of a problem with these examples, as they are perfect examples of how species adapt to their environments. I don’t think that any of them give any solid support for macroevolutionary claims, and though Carroll argues strongly for evolution, he mentions the massive amount of information packed in these DNA structures several times.
He never explained how this toolbox of information evolved and certainly didn’t come anywhere near giving an explanation for the origin of new body plans. We are simply to assume that these adaptation mechanisms have the capability to support the notion that everything we see in the world today evolved from that first common ancestor. Certainly we find similarities between all living creatures in our chemical and physical make-up, but that doesn’t necessarily conclude that the evolutionary interpretation of common ancestry is the most accurate explanation for these similarities. This link provides another interpretation to consider. Also, Stephen Meyers mentions DNA in a section titled “Novel Body Parts” in this peer reviewed article, which is an interesting read. Here is one more article to peruse on the subject.
When considering the origin of these first life forms, how do evolutionary mechanisms account for the messages and information being passed on from generation to generation? Where did that information evolve from if there were not intelligence involved?
========================
Carroll’s second part of the lecture focused on Intelligent Design. He urged his audience to continue their fight against ID. He, of course, mentioned Judge Jones ruling on Intelligent Design and provided a couple of his quotes rejecting ID as science. I’m not sure if those were actually Jones’ words or if they were some of the phrases Jones copied from the ACLU attorney’s notes. Either way, I’m trying to figure out whether scientists like Carroll actually understand ID or if they are so vehemently opposed to anyone questioning their pet theory that they reject ID regardless of it’s merit.
It certainly seems to me that ID doesn’t negate one word of what Carroll lectured on last night, so I’m struggling to figure out why he feels threatened by the design inference. The only problem I can see is that Carroll believes that his simple examples of natural selection along with other evolutionary mechanisms and DNA pattern mutations can account for the vast amount of information packed into each body plan we observe in nature today. ID doesn’t necessarily reject common descent, but it does reject the idea that the information we observe in every living creature evolved without a source of intelligence.
He then went on to mention a few ways in which to try to reach the public and sell them on evolution.
One suggestion was to spend more time with the general public in trying to explain to them how evolution works, and do that by giving more lectures similar to his. Scientists from the crowd were also considering the best way to go about reaching the public. It was kind of funny because it appeared to me that I was probably the only doubting Thomas in the room, and I wondered how they were going to get others like me to listen to them with the attitudes displayed. Carroll was pretty good at being considerate of those who reject areas of the ToE right up until the end of the lecture. During the Q&A, he got a bit lively about the complete ignorance of those who don’t agree with his science, and poked fun of us a bit as well. At one point, I had decided that after the lecture, I’d ask him a few questions about mutational gene comparisons between various body types, but after a few of the comments at the end, I no longer felt comfortable doing that.
Carroll felt that the best approach to reaching the public was to infiltrate the churches. The idea being that scientists should share their ~vast unquestionable knowledge~ of evolution with the churches and convince clergy and parishioners that evolution in no way conflicts with their faith beliefs and that religious beliefs and evolution are compatible. Now, of course, that will work with those congregations that no longer consider scripture the way in which Christ, the Apostles, and the early Christians accepted it (as God’s inerrant word to his people). For some, it has becoming increasingly hard to clarify what exactly they do believe within the pages of scripture as they have to keep adjusting it to fit with current (and ever changing) scientific data. Which areas of scripture are historic and which are merely analogies, metaphor or parables?
He mentioned that he grew up in the Catholic schools and was taught evolution by the clergy, but of course his definition of evolution is quite ambiguous, so it’s hard to tell exactly what that teaching entailed. Of course, the Catholic church doesn’t reject common descent, but many Catholics I know personally question it, and it appears that the new Pope is not at all opposed to Intelligent Design. Even many churches who question a “literal interpretation” of various historical events in the bible embrace design because it doesn’t necessarily reject common descent.
So, all in all, it was an interesting lecture, but I’m still not convinced that ID is not science. In fact, the more I hear about DNA and other sources of information, the more excited about ID I become.
I had a weird dream the night of the lecture. I dreamt that I was back at Forum Hall and Carroll had just finished with his lecture. I went down to talk to him, and there were a couple creationists there asking him questions and getting a bit put off with his answers. I can’t remember what they were saying, but everyone else around was giving them strange looks, like “What the heck is wrong with these people.. why don't they get it?”. So, I hightailed it out of the lecture hall. I can’t believe I actually dreamt that, but it’s the gosh honest truth. I must be taking this crap too seriously.
Carroll did a fine job of explaining the mechanisms of evolution, and he used some interesting creatures to provide examples of the process.
I think the Ice Fish example was my favorite. I have heard of this fish, but I had never seen pictures of it. It has a transparent, pale looking appearance which is due to the interesting fact that it’s blood is colorless, and cells are present in only 1% of it’s blood. They completely lack red blood cells making it unique in comparison to other vertebrates. Due to the extreme cold water in their habitat in the South Atlantic Ocean, this adaptation has made it easier for them to pump blood thru their capillaries.
Carroll gives an account of how this particular fish adapted to it’s environment through evolutionary processes. He explains how, through dramatic environmental changes that took place over millions of years, the ice fish evolved in order to adapt to these changes and their DNA record can tell us a bit about their history.
He explained how the DNA record can tell us what was lost, modified, and gained through evolutionary mechanisms of this fish and other creatures as well.
A key loss was their globin genes. In other Antarctic fish, there are two globin genes located in their DNA which account for their red blood cells. But, in the Ice Fish, there is only a remnant of one of these genes left. So, although they have had an entire loss of red-blood cells, there is this remnant part of the gene which accounts for red blood cells we find in other fish, yet it has no function in the Ice Fish and is left “rotting” within their DNA.
Then there is a modification to their tubulin genes which has aided in adaptation to the cold habitat they live in, and a key invention (gain) would be an antifreeze gene which arose from preexisting DNA code.
Carroll tells us that the DNA record shows how species are created and that earth and life evolved together. Shifts in lifestyle are reflected in DNA of pertinent genes, and Darwin's principles of natural selection aid in these changes.
He gave various examples of how natural selection works. One was an example of the change in uniform color of soldiers throughout early history. British at one time wore bright red uniforms which were easily spotted by the enemy, and rather than lose more soldiers to a fashion statement, they resorted to khaki uniforms in order to blend in to their environment. Obviously, the khaki would aid in self preservation.
Carroll explained that there is one single gene (Mc1r) that accounts for these mice being either black or khaki. Obviously, if their habitat is dark in color such as the Pinacate lava flow in Arizona those mice that are black will survive due to the fact that they blend in with their environment and are difficult for owls or other predators to see. Those that were khaki would not survive to pass on their genes and therefore, the black mice would become the prevalent mice in the area. The opposite would occur in a habitat that blended with the khaki mice coloring - their genes would pass on to their offspring and you would find a greater number of khaki mice in the area.
He also gave example of gene differences which affect the opsin in birds and fish and how mutations that occur will be advantagous for certain animals in their particular habitat, and the cause of it is merely a mutation in their gene that is passed down. If the capability is no longer needed or used, it may mutate further and it would be no loss or gain because it is no longer needed.
For example, the clown fish has a perfect opsin gene. This works well for this little fish in it’s bright and colorful environment. But, the coelacanth has 4 mutations to it’s opsin gene which disrupts it’s vision. Considering it’s deep sea environment, these mutations don’t hinder it’s lifestyle.
That pretty much wrapped up the evidence he gave for evolution. I can't say that I have much of a problem with these examples, as they are perfect examples of how species adapt to their environments. I don’t think that any of them give any solid support for macroevolutionary claims, and though Carroll argues strongly for evolution, he mentions the massive amount of information packed in these DNA structures several times.
He never explained how this toolbox of information evolved and certainly didn’t come anywhere near giving an explanation for the origin of new body plans. We are simply to assume that these adaptation mechanisms have the capability to support the notion that everything we see in the world today evolved from that first common ancestor. Certainly we find similarities between all living creatures in our chemical and physical make-up, but that doesn’t necessarily conclude that the evolutionary interpretation of common ancestry is the most accurate explanation for these similarities. This link provides another interpretation to consider. Also, Stephen Meyers mentions DNA in a section titled “Novel Body Parts” in this peer reviewed article, which is an interesting read. Here is one more article to peruse on the subject.
When considering the origin of these first life forms, how do evolutionary mechanisms account for the messages and information being passed on from generation to generation? Where did that information evolve from if there were not intelligence involved?
========================
Carroll’s second part of the lecture focused on Intelligent Design. He urged his audience to continue their fight against ID. He, of course, mentioned Judge Jones ruling on Intelligent Design and provided a couple of his quotes rejecting ID as science. I’m not sure if those were actually Jones’ words or if they were some of the phrases Jones copied from the ACLU attorney’s notes. Either way, I’m trying to figure out whether scientists like Carroll actually understand ID or if they are so vehemently opposed to anyone questioning their pet theory that they reject ID regardless of it’s merit.
It certainly seems to me that ID doesn’t negate one word of what Carroll lectured on last night, so I’m struggling to figure out why he feels threatened by the design inference. The only problem I can see is that Carroll believes that his simple examples of natural selection along with other evolutionary mechanisms and DNA pattern mutations can account for the vast amount of information packed into each body plan we observe in nature today. ID doesn’t necessarily reject common descent, but it does reject the idea that the information we observe in every living creature evolved without a source of intelligence.
He then went on to mention a few ways in which to try to reach the public and sell them on evolution.
One suggestion was to spend more time with the general public in trying to explain to them how evolution works, and do that by giving more lectures similar to his. Scientists from the crowd were also considering the best way to go about reaching the public. It was kind of funny because it appeared to me that I was probably the only doubting Thomas in the room, and I wondered how they were going to get others like me to listen to them with the attitudes displayed. Carroll was pretty good at being considerate of those who reject areas of the ToE right up until the end of the lecture. During the Q&A, he got a bit lively about the complete ignorance of those who don’t agree with his science, and poked fun of us a bit as well. At one point, I had decided that after the lecture, I’d ask him a few questions about mutational gene comparisons between various body types, but after a few of the comments at the end, I no longer felt comfortable doing that.
Carroll felt that the best approach to reaching the public was to infiltrate the churches. The idea being that scientists should share their ~vast unquestionable knowledge~ of evolution with the churches and convince clergy and parishioners that evolution in no way conflicts with their faith beliefs and that religious beliefs and evolution are compatible. Now, of course, that will work with those congregations that no longer consider scripture the way in which Christ, the Apostles, and the early Christians accepted it (as God’s inerrant word to his people). For some, it has becoming increasingly hard to clarify what exactly they do believe within the pages of scripture as they have to keep adjusting it to fit with current (and ever changing) scientific data. Which areas of scripture are historic and which are merely analogies, metaphor or parables?
He mentioned that he grew up in the Catholic schools and was taught evolution by the clergy, but of course his definition of evolution is quite ambiguous, so it’s hard to tell exactly what that teaching entailed. Of course, the Catholic church doesn’t reject common descent, but many Catholics I know personally question it, and it appears that the new Pope is not at all opposed to Intelligent Design. Even many churches who question a “literal interpretation” of various historical events in the bible embrace design because it doesn’t necessarily reject common descent.
So, all in all, it was an interesting lecture, but I’m still not convinced that ID is not science. In fact, the more I hear about DNA and other sources of information, the more excited about ID I become.
I had a weird dream the night of the lecture. I dreamt that I was back at Forum Hall and Carroll had just finished with his lecture. I went down to talk to him, and there were a couple creationists there asking him questions and getting a bit put off with his answers. I can’t remember what they were saying, but everyone else around was giving them strange looks, like “What the heck is wrong with these people.. why don't they get it?”. So, I hightailed it out of the lecture hall. I can’t believe I actually dreamt that, but it’s the gosh honest truth. I must be taking this crap too seriously.
Subscribe to:
Posts (Atom)

