My sixth grade son is learning about DNA in science class this semester. His teacher showed them this cute little DNA-O-Gram website.
Here is a strand of DNA for you to decode:
AAGGGCGCTGCTGGCGGAATGCGTGGACTCCTTGTCGTTGTATC
AATGGATGTCATGCGTATGGAACGTGTACTCCTT
[Make sure there is no space between the C in the first line and the A in the second when you decode it.]
